Incidental Mutation 'R5360:Gabra5'
ID424287
Institutional Source Beutler Lab
Gene Symbol Gabra5
Ensembl Gene ENSMUSG00000055078
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 5
SynonymsA230018I05Rik
MMRRC Submission 042939-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R5360 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location57407672-57510059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57490785 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 55 (G55R)
Ref Sequence ENSEMBL: ENSMUSP00000145685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068456] [ENSMUST00000085240] [ENSMUST00000206382] [ENSMUST00000206734]
Predicted Effect probably damaging
Transcript: ENSMUST00000068456
AA Change: G55R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063276
Gene: ENSMUSG00000055078
AA Change: G55R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 49 257 3e-50 PFAM
Pfam:Neur_chan_memb 264 375 2.3e-33 PFAM
low complexity region 407 419 N/A INTRINSIC
transmembrane domain 432 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085240
SMART Domains Protein: ENSMUSP00000082337
Gene: ENSMUSG00000033676

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 5.1e-51 PFAM
Pfam:Neur_chan_memb 250 468 1.8e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206382
AA Change: G55R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206734
AA Change: G55R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. Transcript variants utilizing three different alternative non-coding first exons have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice having disruptions in this gene display abnormalities in hearing and in ear structure. Subtle abnormalities in learning and in conditioning have also been reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Acsl5 T A 19: 55,291,160 Y443* probably null Het
Aox3 C T 1: 58,146,508 T331M probably damaging Het
Arhgap32 G A 9: 32,259,671 R1598H probably damaging Het
Atp1a2 A G 1: 172,278,869 probably null Het
Brpf3 A T 17: 28,810,562 M499L probably benign Het
Cacnb1 A T 11: 98,018,271 probably null Het
Cep295 A G 9: 15,326,733 S1899P probably damaging Het
Cntn2 A G 1: 132,518,857 Y748H probably damaging Het
Csmd3 T A 15: 47,669,203 Y2532F probably damaging Het
D17Wsu92e A T 17: 27,794,046 I59N probably damaging Het
Dsg1a A G 18: 20,340,954 D1028G probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gdf9 T A 11: 53,437,207 F330Y probably benign Het
Gimap8 T C 6: 48,656,302 S352P probably damaging Het
Gm4952 A T 19: 12,623,629 H71L probably benign Het
Gm6803 A C 12: 88,018,495 L93V probably benign Het
Gnaq G A 19: 16,133,426 R34H probably benign Het
Hebp2 T C 10: 18,544,307 D126G probably benign Het
Hectd4 A G 5: 121,315,401 D601G possibly damaging Het
Hook2 T C 8: 85,001,404 Y577H probably damaging Het
Igfals A G 17: 24,880,093 T53A probably benign Het
Igsf9b A G 9: 27,311,672 D123G probably damaging Het
Ikbkap A T 4: 56,800,104 H7Q probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mdm4 A T 1: 132,991,658 *490K probably null Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Neurl2 C A 2: 164,833,101 A114S probably damaging Het
Nuggc A G 14: 65,638,626 T563A probably damaging Het
Olfr951 T G 9: 39,394,402 F204V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pdlim1 A T 19: 40,230,549 S213T probably damaging Het
Pitx1 T C 13: 55,828,478 I123V probably damaging Het
Pkd1l1 T C 11: 8,879,204 N1013D probably benign Het
Pla2g2c T A 4: 138,734,345 Y42N possibly damaging Het
Polr2b G A 5: 77,349,146 A1168T possibly damaging Het
Ppp2r2a G A 14: 67,016,571 R383* probably null Het
Prl7a2 C T 13: 27,659,160 R220H probably benign Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rc3h2 A G 2: 37,389,855 V454A possibly damaging Het
Robo1 A G 16: 72,935,777 T307A probably damaging Het
Slc22a6 T C 19: 8,619,422 L188P probably damaging Het
Spag17 A G 3: 100,109,410 N2167S probably benign Het
Spag5 G A 11: 78,314,762 E680K probably damaging Het
Spata6 A G 4: 111,822,829 Y428C possibly damaging Het
Tbc1d5 T C 17: 50,984,632 D47G probably benign Het
Trp53 T C 11: 69,588,740 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ttc39b T C 4: 83,261,847 D103G probably damaging Het
Ttn A C 2: 76,919,978 W3576G probably benign Het
Yeats2 T A 16: 20,154,162 M22K probably damaging Het
Other mutations in Gabra5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gabra5 APN 7 57488988 missense probably damaging 1.00
IGL01475:Gabra5 APN 7 57408684 missense probably damaging 1.00
IGL02750:Gabra5 APN 7 57507991 missense probably benign 0.01
PIT4581001:Gabra5 UTSW 7 57488857 missense probably damaging 1.00
R0003:Gabra5 UTSW 7 57413728 missense probably damaging 1.00
R1519:Gabra5 UTSW 7 57408893 missense probably benign 0.39
R1740:Gabra5 UTSW 7 57421842 missense probably benign
R1766:Gabra5 UTSW 7 57508048 missense probably benign 0.05
R1865:Gabra5 UTSW 7 57489192 nonsense probably null
R2024:Gabra5 UTSW 7 57488950 missense probably damaging 1.00
R2143:Gabra5 UTSW 7 57489015 missense probably damaging 1.00
R2444:Gabra5 UTSW 7 57408875 missense probably benign
R2829:Gabra5 UTSW 7 57490835 missense probably benign
R2966:Gabra5 UTSW 7 57408641 missense probably damaging 0.99
R4014:Gabra5 UTSW 7 57489010 missense probably damaging 1.00
R4876:Gabra5 UTSW 7 57413665 missense probably damaging 1.00
R4936:Gabra5 UTSW 7 57408799 missense probably benign 0.32
R5217:Gabra5 UTSW 7 57490856 missense probably benign 0.00
R6021:Gabra5 UTSW 7 57507992 missense probably benign 0.00
R6340:Gabra5 UTSW 7 57413748 missense probably damaging 1.00
R6351:Gabra5 UTSW 7 57413780 missense probably damaging 1.00
R6751:Gabra5 UTSW 7 57418334 missense probably damaging 1.00
R7267:Gabra5 UTSW 7 57490781 missense probably damaging 1.00
X0028:Gabra5 UTSW 7 57488911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACTACTTTCCTCCAGCTTCATG -3'
(R):5'- CCAAGGTCAGATGCCATGTG -3'

Sequencing Primer
(F):5'- CTCCAGCTTCATGAATCTGTAAAATG -3'
(R):5'- CAAGGTCAGATGCCATGTGAGTATTG -3'
Posted On2016-08-04