Mutagenetix > Incidental Mutations

Incidental Mutation 'R5360:Hook2'

424288

Institutional Source

Beutler Lab

Gene Symbol

Hook2

Ensembl Gene

ENSMUSG00000052566

Gene Name

hook microtubule tethering protein 2

Synonyms

MMRRC Submission

042939-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.268) question?

Stock #

R5360 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84990603-85003349 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85001404 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 577 (Y577H)

Ref Sequence

ENSEMBL: ENSMUSP00000148237 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064495] [ENSMUST00000209764] [ENSMUST00000210326]

Predicted Effect

probably damaging
Transcript: ENSMUST00000064495
AA Change: Y601H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067752
Gene: ENSMUSG00000052566
AA Change: Y601H

Domain	Start	End	E-Value	Type
Pfam:HOOK	8	703	2.3e-277	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209652

Predicted Effect

probably damaging
Transcript: ENSMUST00000209764
AA Change: Y577H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000210326

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Acsl5	T	A	19: 55,291,160	Y443*	probably null	Het
Aox3	C	T	1: 58,146,508	T331M	probably damaging	Het
Arhgap32	G	A	9: 32,259,671	R1598H	probably damaging	Het
Atp1a2	A	G	1: 172,278,869		probably null	Het
Brpf3	A	T	17: 28,810,562	M499L	probably benign	Het
Cacnb1	A	T	11: 98,018,271		probably null	Het
Cep295	A	G	9: 15,326,733	S1899P	probably damaging	Het
Cntn2	A	G	1: 132,518,857	Y748H	probably damaging	Het
Csmd3	T	A	15: 47,669,203	Y2532F	probably damaging	Het
D17Wsu92e	A	T	17: 27,794,046	I59N	probably damaging	Het
Dsg1a	A	G	18: 20,340,954	D1028G	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gabra5	C	T	7: 57,490,785	G55R	probably damaging	Het
Gdf9	T	A	11: 53,437,207	F330Y	probably benign	Het
Gimap8	T	C	6: 48,656,302	S352P	probably damaging	Het
Gm4952	A	T	19: 12,623,629	H71L	probably benign	Het
Gm6803	A	C	12: 88,018,495	L93V	probably benign	Het
Gnaq	G	A	19: 16,133,426	R34H	probably benign	Het
Hebp2	T	C	10: 18,544,307	D126G	probably benign	Het
Hectd4	A	G	5: 121,315,401	D601G	possibly damaging	Het
Igfals	A	G	17: 24,880,093	T53A	probably benign	Het
Igsf9b	A	G	9: 27,311,672	D123G	probably damaging	Het
Ikbkap	A	T	4: 56,800,104	H7Q	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mdm4	A	T	1: 132,991,658	*490K	probably null	Het
Melk	C	T	4: 44,363,730	T592M	probably damaging	Het
Neurl2	C	A	2: 164,833,101	A114S	probably damaging	Het
Nuggc	A	G	14: 65,638,626	T563A	probably damaging	Het
Olfr951	T	G	9: 39,394,402	F204V	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pdlim1	A	T	19: 40,230,549	S213T	probably damaging	Het
Pitx1	T	C	13: 55,828,478	I123V	probably damaging	Het
Pkd1l1	T	C	11: 8,879,204	N1013D	probably benign	Het
Pla2g2c	T	A	4: 138,734,345	Y42N	possibly damaging	Het
Polr2b	G	A	5: 77,349,146	A1168T	possibly damaging	Het
Ppp2r2a	G	A	14: 67,016,571	R383*	probably null	Het
Prl7a2	C	T	13: 27,659,160	R220H	probably benign	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rc3h2	A	G	2: 37,389,855	V454A	possibly damaging	Het
Robo1	A	G	16: 72,935,777	T307A	probably damaging	Het
Slc22a6	T	C	19: 8,619,422	L188P	probably damaging	Het
Spag17	A	G	3: 100,109,410	N2167S	probably benign	Het
Spag5	G	A	11: 78,314,762	E680K	probably damaging	Het
Spata6	A	G	4: 111,822,829	Y428C	possibly damaging	Het
Tbc1d5	T	C	17: 50,984,632	D47G	probably benign	Het
Trp53	T	C	11: 69,588,740		probably null	Het
Tsc22d1	TCAGCAGCAGCAGCAGCAGCAGCAGCA	TCAGCAGCAGCAGCAGCAGCAGCA	14: 76,417,267		probably benign	Het
Ttc39b	T	C	4: 83,261,847	D103G	probably damaging	Het
Ttn	A	C	2: 76,919,978	W3576G	probably benign	Het
Yeats2	T	A	16: 20,154,162	M22K	probably damaging	Het

Other mutations in Hook2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00921:Hook2	APN	8	85002497	unclassified	probably benign
IGL01161:Hook2	APN	8	84994931	missense	probably benign	0.05
IGL01535:Hook2	APN	8	85002989	missense	probably benign	0.00
IGL01668:Hook2	APN	8	84993578	missense	possibly damaging	0.88
IGL01749:Hook2	APN	8	84993236	critical splice donor site	probably null
IGL01750:Hook2	APN	8	84993236	critical splice donor site	probably null
IGL01753:Hook2	APN	8	84993236	critical splice donor site	probably null
IGL01900:Hook2	APN	8	85001311	unclassified	probably benign
IGL02157:Hook2	APN	8	85001150	unclassified	probably benign
IGL02175:Hook2	APN	8	84991402	missense	probably damaging	1.00
IGL02350:Hook2	APN	8	84994985	nonsense	probably null
IGL02357:Hook2	APN	8	84994985	nonsense	probably null
IGL03377:Hook2	APN	8	85001335	nonsense	probably null
R0399:Hook2	UTSW	8	84993567	splice site	probably benign
R1133:Hook2	UTSW	8	84995804	missense	probably damaging	1.00
R2087:Hook2	UTSW	8	85002691	missense	probably damaging	0.98
R2277:Hook2	UTSW	8	85002931	nonsense	probably null
R2398:Hook2	UTSW	8	84991299	missense	probably damaging	0.98
R3406:Hook2	UTSW	8	84993984	splice site	probably benign
R4752:Hook2	UTSW	8	85002720	nonsense	probably null
R5014:Hook2	UTSW	8	84991377	missense	probably damaging	1.00
R5068:Hook2	UTSW	8	84993399	missense	possibly damaging	0.81
R5195:Hook2	UTSW	8	84994776	missense	probably damaging	1.00
R5597:Hook2	UTSW	8	84994028	missense	probably benign	0.00
R5614:Hook2	UTSW	8	85002508	missense	probably damaging	1.00
R5843:Hook2	UTSW	8	84991283	missense	probably damaging	0.99
R5931:Hook2	UTSW	8	84995746	nonsense	probably null
R5942:Hook2	UTSW	8	84994780	splice site	probably null
R6120:Hook2	UTSW	8	84998125	missense	probably damaging	1.00
R6167:Hook2	UTSW	8	84995013	missense	probably damaging	1.00
R6936:Hook2	UTSW	8	85002998	missense	probably benign	0.04
R6992:Hook2	UTSW	8	85002556	missense	probably damaging	1.00
R7058:Hook2	UTSW	8	84997411	missense	possibly damaging	0.89
R7101:Hook2	UTSW	8	84997051	missense	probably benign
R7177:Hook2	UTSW	8	84991417	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- CCACTGACAGCAGCAGTAAGTG -3'
(R):5'- AGACCCTTTAACACGCTGAG -3'

Sequencing Primer
(F):5'- CAGTAAGTGGGGCCCAAC -3'
(R):5'- CTGAGTACAATGGATTTGACAGCCC -3'

Posted On

2016-08-04