Mutagenetix > Incidental Mutations

Incidental Mutation 'R5360:Igsf9b'

424290

Institutional Source

Beutler Lab

Gene Symbol

Igsf9b

Ensembl Gene

ENSMUSG00000034275

Gene Name

immunoglobulin superfamily, member 9B

Synonyms

LOC235086

MMRRC Submission

042939-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.548) question?

Stock #

R5360 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27299204-27357546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27311672 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 123 (D123G)

Ref Sequence

ENSEMBL: ENSMUSP00000149356 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115247
AA Change: D123G

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: D123G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000133213
AA Change: D123G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: D123G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART
transmembrane domain	727	749	N/A	INTRINSIC
low complexity region	750	760	N/A	INTRINSIC
low complexity region	835	843	N/A	INTRINSIC
low complexity region	971	982	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1148	1161	N/A	INTRINSIC
low complexity region	1172	1190	N/A	INTRINSIC
low complexity region	1246	1273	N/A	INTRINSIC
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1313	1326	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000214357
AA Change: D123G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Acsl5	T	A	19: 55,291,160	Y443*	probably null	Het
Aox3	C	T	1: 58,146,508	T331M	probably damaging	Het
Arhgap32	G	A	9: 32,259,671	R1598H	probably damaging	Het
Atp1a2	A	G	1: 172,278,869		probably null	Het
Brpf3	A	T	17: 28,810,562	M499L	probably benign	Het
Cacnb1	A	T	11: 98,018,271		probably null	Het
Cep295	A	G	9: 15,326,733	S1899P	probably damaging	Het
Cntn2	A	G	1: 132,518,857	Y748H	probably damaging	Het
Csmd3	T	A	15: 47,669,203	Y2532F	probably damaging	Het
D17Wsu92e	A	T	17: 27,794,046	I59N	probably damaging	Het
Dsg1a	A	G	18: 20,340,954	D1028G	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gabra5	C	T	7: 57,490,785	G55R	probably damaging	Het
Gdf9	T	A	11: 53,437,207	F330Y	probably benign	Het
Gimap8	T	C	6: 48,656,302	S352P	probably damaging	Het
Gm4952	A	T	19: 12,623,629	H71L	probably benign	Het
Gm6803	A	C	12: 88,018,495	L93V	probably benign	Het
Gnaq	G	A	19: 16,133,426	R34H	probably benign	Het
Hebp2	T	C	10: 18,544,307	D126G	probably benign	Het
Hectd4	A	G	5: 121,315,401	D601G	possibly damaging	Het
Hook2	T	C	8: 85,001,404	Y577H	probably damaging	Het
Igfals	A	G	17: 24,880,093	T53A	probably benign	Het
Ikbkap	A	T	4: 56,800,104	H7Q	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mdm4	A	T	1: 132,991,658	*490K	probably null	Het
Melk	C	T	4: 44,363,730	T592M	probably damaging	Het
Neurl2	C	A	2: 164,833,101	A114S	probably damaging	Het
Nuggc	A	G	14: 65,638,626	T563A	probably damaging	Het
Olfr951	T	G	9: 39,394,402	F204V	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pdlim1	A	T	19: 40,230,549	S213T	probably damaging	Het
Pitx1	T	C	13: 55,828,478	I123V	probably damaging	Het
Pkd1l1	T	C	11: 8,879,204	N1013D	probably benign	Het
Pla2g2c	T	A	4: 138,734,345	Y42N	possibly damaging	Het
Polr2b	G	A	5: 77,349,146	A1168T	possibly damaging	Het
Ppp2r2a	G	A	14: 67,016,571	R383*	probably null	Het
Prl7a2	C	T	13: 27,659,160	R220H	probably benign	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rc3h2	A	G	2: 37,389,855	V454A	possibly damaging	Het
Robo1	A	G	16: 72,935,777	T307A	probably damaging	Het
Slc22a6	T	C	19: 8,619,422	L188P	probably damaging	Het
Spag17	A	G	3: 100,109,410	N2167S	probably benign	Het
Spag5	G	A	11: 78,314,762	E680K	probably damaging	Het
Spata6	A	G	4: 111,822,829	Y428C	possibly damaging	Het
Tbc1d5	T	C	17: 50,984,632	D47G	probably benign	Het
Trp53	T	C	11: 69,588,740		probably null	Het
Tsc22d1	TCAGCAGCAGCAGCAGCAGCAGCAGCA	TCAGCAGCAGCAGCAGCAGCAGCA	14: 76,417,267		probably benign	Het
Ttc39b	T	C	4: 83,261,847	D103G	probably damaging	Het
Ttn	A	C	2: 76,919,978	W3576G	probably benign	Het
Yeats2	T	A	16: 20,154,162	M22K	probably damaging	Het

Other mutations in Igsf9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Igsf9b	APN	9	27319655	missense	probably damaging	1.00
IGL01013:Igsf9b	APN	9	27334304	missense	probably damaging	1.00
IGL01960:Igsf9b	APN	9	27328606	missense	possibly damaging	0.93
IGL02398:Igsf9b	APN	9	27333130	missense	possibly damaging	0.54
IGL03007:Igsf9b	APN	9	27333082	missense	probably damaging	0.98
IGL03014:Igsf9b	UTSW	9	27322636	missense	probably benign	0.00
R0127:Igsf9b	UTSW	9	27334385	missense	possibly damaging	0.65
R0376:Igsf9b	UTSW	9	27334582	missense	probably benign	0.01
R0520:Igsf9b	UTSW	9	27323250	missense	probably benign	0.00
R0534:Igsf9b	UTSW	9	27333062	splice site	probably null
R0613:Igsf9b	UTSW	9	27326920	missense	probably damaging	1.00
R0718:Igsf9b	UTSW	9	27323361	critical splice donor site	probably null
R0828:Igsf9b	UTSW	9	27319605	nonsense	probably null
R0879:Igsf9b	UTSW	9	27333742	missense	probably damaging	1.00
R0882:Igsf9b	UTSW	9	27319316	missense	probably damaging	0.98
R0987:Igsf9b	UTSW	9	27332553	splice site	probably null
R1162:Igsf9b	UTSW	9	27326889	missense	probably benign
R1758:Igsf9b	UTSW	9	27334252	missense	possibly damaging	0.50
R1760:Igsf9b	UTSW	9	27317827	missense	possibly damaging	0.82
R1819:Igsf9b	UTSW	9	27311593	missense	probably damaging	0.98
R1823:Igsf9b	UTSW	9	27331732	missense	probably damaging	0.96
R1982:Igsf9b	UTSW	9	27322239	missense	possibly damaging	0.82
R2150:Igsf9b	UTSW	9	27334337	missense	probably damaging	1.00
R2228:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2229:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2250:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R3415:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3416:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3417:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3427:Igsf9b	UTSW	9	27334577	missense	probably damaging	0.99
R4356:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4357:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4358:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4359:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4379:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4416:Igsf9b	UTSW	9	27322917	missense	probably damaging	1.00
R4445:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4446:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4787:Igsf9b	UTSW	9	27317456	missense	probably benign	0.26
R4887:Igsf9b	UTSW	9	27322650	missense	probably benign	0.45
R5085:Igsf9b	UTSW	9	27317437	missense	probably benign	0.03
R5417:Igsf9b	UTSW	9	27334276	small insertion	probably benign
R5686:Igsf9b	UTSW	9	27324179	missense	probably damaging	0.99
R5738:Igsf9b	UTSW	9	27328530	missense	probably damaging	0.98
R5869:Igsf9b	UTSW	9	27323235	missense	probably benign	0.44
R6304:Igsf9b	UTSW	9	27342575	missense	probably benign	0.19
R6359:Igsf9b	UTSW	9	27309599	missense	probably benign	0.25
R6367:Igsf9b	UTSW	9	27309525	nonsense	probably null
R6556:Igsf9b	UTSW	9	27329555	missense	probably damaging	1.00
R7058:Igsf9b	UTSW	9	27322854	missense	probably damaging	0.99
R7165:Igsf9b	UTSW	9	27334240	missense	probably benign
R7180:Igsf9b	UTSW	9	27322668	missense	possibly damaging	0.95
R7212:Igsf9b	UTSW	9	27331696	missense	probably damaging	0.98
R7461:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R7605:Igsf9b	UTSW	9	27323312	missense	probably damaging	0.98
R7609:Igsf9b	UTSW	9	27345890	missense	probably benign
R7613:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R8072:Igsf9b	UTSW	9	27317364	missense	possibly damaging	0.94
R8163:Igsf9b	UTSW	9	27322611	splice site	probably null
X0013:Igsf9b	UTSW	9	27331725	missense	possibly damaging	0.89
X0025:Igsf9b	UTSW	9	27309461	missense	probably damaging	1.00
X0028:Igsf9b	UTSW	9	27334372	missense	probably damaging	1.00
Z1176:Igsf9b	UTSW	9	27317353	critical splice acceptor site	probably null
Z1177:Igsf9b	UTSW	9	27334292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGAGCGGATAGATTTGCTCTG -3'
(R):5'- GACCTGCTGCTTTCACACAC -3'

Sequencing Primer
(F):5'- GATGGATTGGTCTGATGGCTCAC -3'
(R):5'- TACTGACCCATAAATTCCAGGAATG -3'

Posted On

2016-08-04