Incidental Mutation 'R5360:Olfr951'
ID424292
Institutional Source Beutler Lab
Gene Symbol Olfr951
Ensembl Gene ENSMUSG00000094269
Gene Nameolfactory receptor 951
SynonymsMOR171-49, MOR171-33P, GA_x6K02T2PVTD-33090395-33091330
MMRRC Submission 042939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5360 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39387410-39395633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 39394402 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 204 (F204V)
Ref Sequence ENSEMBL: ENSMUSP00000077615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078531] [ENSMUST00000216107]
Predicted Effect probably benign
Transcript: ENSMUST00000078531
AA Change: F204V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077615
Gene: ENSMUSG00000094269
AA Change: F204V

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.5e-52 PFAM
Pfam:7tm_1 44 293 5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216107
AA Change: F201V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Acsl5 T A 19: 55,291,160 Y443* probably null Het
Aox3 C T 1: 58,146,508 T331M probably damaging Het
Arhgap32 G A 9: 32,259,671 R1598H probably damaging Het
Atp1a2 A G 1: 172,278,869 probably null Het
Brpf3 A T 17: 28,810,562 M499L probably benign Het
Cacnb1 A T 11: 98,018,271 probably null Het
Cep295 A G 9: 15,326,733 S1899P probably damaging Het
Cntn2 A G 1: 132,518,857 Y748H probably damaging Het
Csmd3 T A 15: 47,669,203 Y2532F probably damaging Het
D17Wsu92e A T 17: 27,794,046 I59N probably damaging Het
Dsg1a A G 18: 20,340,954 D1028G probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabra5 C T 7: 57,490,785 G55R probably damaging Het
Gdf9 T A 11: 53,437,207 F330Y probably benign Het
Gimap8 T C 6: 48,656,302 S352P probably damaging Het
Gm4952 A T 19: 12,623,629 H71L probably benign Het
Gm6803 A C 12: 88,018,495 L93V probably benign Het
Gnaq G A 19: 16,133,426 R34H probably benign Het
Hebp2 T C 10: 18,544,307 D126G probably benign Het
Hectd4 A G 5: 121,315,401 D601G possibly damaging Het
Hook2 T C 8: 85,001,404 Y577H probably damaging Het
Igfals A G 17: 24,880,093 T53A probably benign Het
Igsf9b A G 9: 27,311,672 D123G probably damaging Het
Ikbkap A T 4: 56,800,104 H7Q probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mdm4 A T 1: 132,991,658 *490K probably null Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Neurl2 C A 2: 164,833,101 A114S probably damaging Het
Nuggc A G 14: 65,638,626 T563A probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pdlim1 A T 19: 40,230,549 S213T probably damaging Het
Pitx1 T C 13: 55,828,478 I123V probably damaging Het
Pkd1l1 T C 11: 8,879,204 N1013D probably benign Het
Pla2g2c T A 4: 138,734,345 Y42N possibly damaging Het
Polr2b G A 5: 77,349,146 A1168T possibly damaging Het
Ppp2r2a G A 14: 67,016,571 R383* probably null Het
Prl7a2 C T 13: 27,659,160 R220H probably benign Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rc3h2 A G 2: 37,389,855 V454A possibly damaging Het
Robo1 A G 16: 72,935,777 T307A probably damaging Het
Slc22a6 T C 19: 8,619,422 L188P probably damaging Het
Spag17 A G 3: 100,109,410 N2167S probably benign Het
Spag5 G A 11: 78,314,762 E680K probably damaging Het
Spata6 A G 4: 111,822,829 Y428C possibly damaging Het
Tbc1d5 T C 17: 50,984,632 D47G probably benign Het
Trp53 T C 11: 69,588,740 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ttc39b T C 4: 83,261,847 D103G probably damaging Het
Ttn A C 2: 76,919,978 W3576G probably benign Het
Yeats2 T A 16: 20,154,162 M22K probably damaging Het
Other mutations in Olfr951
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr951 APN 9 39393818 missense probably benign 0.01
IGL01650:Olfr951 APN 9 39393956 missense probably damaging 0.99
IGL02134:Olfr951 APN 9 39394534 missense probably damaging 0.99
IGL03113:Olfr951 APN 9 39394685 missense probably damaging 1.00
R0127:Olfr951 UTSW 9 39393942 missense probably benign 0.16
R1730:Olfr951 UTSW 9 39394222 missense probably benign 0.01
R1783:Olfr951 UTSW 9 39394222 missense probably benign 0.01
R1924:Olfr951 UTSW 9 39393867 missense possibly damaging 0.93
R3785:Olfr951 UTSW 9 39394382 missense probably benign 0.07
R3787:Olfr951 UTSW 9 39394382 missense probably benign 0.07
R4607:Olfr951 UTSW 9 39394735 makesense probably null
R4803:Olfr951 UTSW 9 39394636 missense probably benign 0.26
R5314:Olfr951 UTSW 9 39394489 missense probably damaging 1.00
R5338:Olfr951 UTSW 9 39394075 missense probably damaging 1.00
R5468:Olfr951 UTSW 9 39393961 missense probably benign 0.33
R6590:Olfr951 UTSW 9 39394549 missense probably benign 0.00
R6690:Olfr951 UTSW 9 39394549 missense probably benign 0.00
R6925:Olfr951 UTSW 9 39393860 missense probably benign 0.32
R6925:Olfr951 UTSW 9 39393861 missense probably benign 0.01
R6982:Olfr951 UTSW 9 39394322 missense probably damaging 1.00
R7662:Olfr951 UTSW 9 39394093 missense probably benign 0.01
R8074:Olfr951 UTSW 9 39393946
Predicted Primers PCR Primer
(F):5'- AGCCATGTCCTCTCAGATTTAC -3'
(R):5'- ATTGAACTCACTTGTGATGGCTG -3'

Sequencing Primer
(F):5'- CAGATTTACTGTTCTCTGATTTCAGG -3'
(R):5'- CTCACTTGTGATGGCTGTAAGTACAC -3'
Posted On2016-08-04