Incidental Mutation 'R5360:Hebp2'
ID424293
Institutional Source Beutler Lab
Gene Symbol Hebp2
Ensembl Gene ENSMUSG00000019853
Gene Nameheme binding protein 2
SynonymsSOUL
MMRRC Submission 042939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R5360 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location18539498-18546076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18544307 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 126 (D126G)
Ref Sequence ENSEMBL: ENSMUSP00000020000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020000] [ENSMUST00000213153] [ENSMUST00000214548]
Predicted Effect probably benign
Transcript: ENSMUST00000020000
AA Change: D126G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020000
Gene: ENSMUSG00000019853
AA Change: D126G

DomainStartEndE-ValueType
Pfam:SOUL 20 195 1.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213153
Predicted Effect probably benign
Transcript: ENSMUST00000214548
AA Change: D126G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found predominately in the cytoplasm, where it plays a role in the collapse of mitochondrial membrane potential (MMP) prior to necrotic cell death. The encoded protein enhances outer and inner mitochondrial membrane permeabilization, especially under conditions of oxidative stress. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Acsl5 T A 19: 55,291,160 Y443* probably null Het
Aox3 C T 1: 58,146,508 T331M probably damaging Het
Arhgap32 G A 9: 32,259,671 R1598H probably damaging Het
Atp1a2 A G 1: 172,278,869 probably null Het
Brpf3 A T 17: 28,810,562 M499L probably benign Het
Cacnb1 A T 11: 98,018,271 probably null Het
Cep295 A G 9: 15,326,733 S1899P probably damaging Het
Cntn2 A G 1: 132,518,857 Y748H probably damaging Het
Csmd3 T A 15: 47,669,203 Y2532F probably damaging Het
D17Wsu92e A T 17: 27,794,046 I59N probably damaging Het
Dsg1a A G 18: 20,340,954 D1028G probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabra5 C T 7: 57,490,785 G55R probably damaging Het
Gdf9 T A 11: 53,437,207 F330Y probably benign Het
Gimap8 T C 6: 48,656,302 S352P probably damaging Het
Gm4952 A T 19: 12,623,629 H71L probably benign Het
Gm6803 A C 12: 88,018,495 L93V probably benign Het
Gnaq G A 19: 16,133,426 R34H probably benign Het
Hectd4 A G 5: 121,315,401 D601G possibly damaging Het
Hook2 T C 8: 85,001,404 Y577H probably damaging Het
Igfals A G 17: 24,880,093 T53A probably benign Het
Igsf9b A G 9: 27,311,672 D123G probably damaging Het
Ikbkap A T 4: 56,800,104 H7Q probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mdm4 A T 1: 132,991,658 *490K probably null Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Neurl2 C A 2: 164,833,101 A114S probably damaging Het
Nuggc A G 14: 65,638,626 T563A probably damaging Het
Olfr951 T G 9: 39,394,402 F204V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pdlim1 A T 19: 40,230,549 S213T probably damaging Het
Pitx1 T C 13: 55,828,478 I123V probably damaging Het
Pkd1l1 T C 11: 8,879,204 N1013D probably benign Het
Pla2g2c T A 4: 138,734,345 Y42N possibly damaging Het
Polr2b G A 5: 77,349,146 A1168T possibly damaging Het
Ppp2r2a G A 14: 67,016,571 R383* probably null Het
Prl7a2 C T 13: 27,659,160 R220H probably benign Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rc3h2 A G 2: 37,389,855 V454A possibly damaging Het
Robo1 A G 16: 72,935,777 T307A probably damaging Het
Slc22a6 T C 19: 8,619,422 L188P probably damaging Het
Spag17 A G 3: 100,109,410 N2167S probably benign Het
Spag5 G A 11: 78,314,762 E680K probably damaging Het
Spata6 A G 4: 111,822,829 Y428C possibly damaging Het
Tbc1d5 T C 17: 50,984,632 D47G probably benign Het
Trp53 T C 11: 69,588,740 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ttc39b T C 4: 83,261,847 D103G probably damaging Het
Ttn A C 2: 76,919,978 W3576G probably benign Het
Yeats2 T A 16: 20,154,162 M22K probably damaging Het
Other mutations in Hebp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1026:Hebp2 UTSW 10 18544415 missense possibly damaging 0.91
R1358:Hebp2 UTSW 10 18544415 missense possibly damaging 0.91
R1360:Hebp2 UTSW 10 18544415 missense possibly damaging 0.91
R1529:Hebp2 UTSW 10 18545761 missense possibly damaging 0.77
R1555:Hebp2 UTSW 10 18544415 missense possibly damaging 0.91
R1679:Hebp2 UTSW 10 18544415 missense possibly damaging 0.91
R1757:Hebp2 UTSW 10 18545101 missense probably damaging 1.00
R2125:Hebp2 UTSW 10 18541260 missense probably benign 0.16
R4969:Hebp2 UTSW 10 18544374 missense probably benign 0.14
R5758:Hebp2 UTSW 10 18544407 missense probably damaging 1.00
R7677:Hebp2 UTSW 10 18545799 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACATCCTGAAATCTAGTAGACGG -3'
(R):5'- GAGTAATGTGTCATTCTACCACTACC -3'

Sequencing Primer
(F):5'- ATCTAGTAGACGGTTCTTATGGAAG -3'
(R):5'- CATCAGCCATAATATGCTAAAATTGC -3'
Posted On2016-08-04