Incidental Mutation 'R5360:R3hdm4'
ID424294
Institutional Source Beutler Lab
Gene Symbol R3hdm4
Ensembl Gene ENSMUSG00000035781
Gene NameR3H domain containing 4
Synonyms
MMRRC Submission 042939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5360 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79910052-79921208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79912458 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 162 (E162K)
Ref Sequence ENSEMBL: ENSMUSP00000132266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045529] [ENSMUST00000045628] [ENSMUST00000105378] [ENSMUST00000164705] [ENSMUST00000165684] [ENSMUST00000166964] [ENSMUST00000170409] [ENSMUST00000171416] [ENSMUST00000181321] [ENSMUST00000217976] [ENSMUST00000218750] [ENSMUST00000218970] [ENSMUST00000219867]
Predicted Effect probably benign
Transcript: ENSMUST00000045529
SMART Domains Protein: ENSMUSP00000040516
Gene: ENSMUSG00000035773

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 53 338 1.7e-6 PFAM
Pfam:7tm_1 59 323 7e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000045628
AA Change: E162K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044570
Gene: ENSMUSG00000035781
AA Change: E162K

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 1.2e-35 PFAM
Pfam:R3H 181 244 7.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105378
SMART Domains Protein: ENSMUSP00000101017
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
WD40 94 133 1.05e-7 SMART
Blast:WD40 143 169 4e-8 BLAST
low complexity region 206 217 N/A INTRINSIC
WD40 226 267 1.53e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163125
Predicted Effect probably benign
Transcript: ENSMUST00000164705
SMART Domains Protein: ENSMUSP00000129229
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 172 6.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165684
SMART Domains Protein: ENSMUSP00000129375
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
WD40 95 134 1.05e-7 SMART
Blast:WD40 144 170 4e-8 BLAST
low complexity region 207 218 N/A INTRINSIC
WD40 227 268 1.53e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166964
SMART Domains Protein: ENSMUSP00000128463
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 59 98 1.05e-7 SMART
Pfam:Med16 108 162 2.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170409
SMART Domains Protein: ENSMUSP00000126729
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 105 1.1e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171416
AA Change: E162K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132266
Gene: ENSMUSG00000035781
AA Change: E162K

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 4.9e-39 PFAM
Pfam:R3H 183 243 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178620
Predicted Effect probably benign
Transcript: ENSMUST00000181321
Predicted Effect probably benign
Transcript: ENSMUST00000217976
Predicted Effect probably benign
Transcript: ENSMUST00000218750
Predicted Effect probably benign
Transcript: ENSMUST00000218970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219358
Predicted Effect probably benign
Transcript: ENSMUST00000219867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219883
Meta Mutation Damage Score 0.1452 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Acsl5 T A 19: 55,291,160 Y443* probably null Het
Aox3 C T 1: 58,146,508 T331M probably damaging Het
Arhgap32 G A 9: 32,259,671 R1598H probably damaging Het
Atp1a2 A G 1: 172,278,869 probably null Het
Brpf3 A T 17: 28,810,562 M499L probably benign Het
Cacnb1 A T 11: 98,018,271 probably null Het
Cep295 A G 9: 15,326,733 S1899P probably damaging Het
Cntn2 A G 1: 132,518,857 Y748H probably damaging Het
Csmd3 T A 15: 47,669,203 Y2532F probably damaging Het
D17Wsu92e A T 17: 27,794,046 I59N probably damaging Het
Dsg1a A G 18: 20,340,954 D1028G probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabra5 C T 7: 57,490,785 G55R probably damaging Het
Gdf9 T A 11: 53,437,207 F330Y probably benign Het
Gimap8 T C 6: 48,656,302 S352P probably damaging Het
Gm4952 A T 19: 12,623,629 H71L probably benign Het
Gm6803 A C 12: 88,018,495 L93V probably benign Het
Gnaq G A 19: 16,133,426 R34H probably benign Het
Hebp2 T C 10: 18,544,307 D126G probably benign Het
Hectd4 A G 5: 121,315,401 D601G possibly damaging Het
Hook2 T C 8: 85,001,404 Y577H probably damaging Het
Igfals A G 17: 24,880,093 T53A probably benign Het
Igsf9b A G 9: 27,311,672 D123G probably damaging Het
Ikbkap A T 4: 56,800,104 H7Q probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mdm4 A T 1: 132,991,658 *490K probably null Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Neurl2 C A 2: 164,833,101 A114S probably damaging Het
Nuggc A G 14: 65,638,626 T563A probably damaging Het
Olfr951 T G 9: 39,394,402 F204V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pdlim1 A T 19: 40,230,549 S213T probably damaging Het
Pitx1 T C 13: 55,828,478 I123V probably damaging Het
Pkd1l1 T C 11: 8,879,204 N1013D probably benign Het
Pla2g2c T A 4: 138,734,345 Y42N possibly damaging Het
Polr2b G A 5: 77,349,146 A1168T possibly damaging Het
Ppp2r2a G A 14: 67,016,571 R383* probably null Het
Prl7a2 C T 13: 27,659,160 R220H probably benign Het
Rc3h2 A G 2: 37,389,855 V454A possibly damaging Het
Robo1 A G 16: 72,935,777 T307A probably damaging Het
Slc22a6 T C 19: 8,619,422 L188P probably damaging Het
Spag17 A G 3: 100,109,410 N2167S probably benign Het
Spag5 G A 11: 78,314,762 E680K probably damaging Het
Spata6 A G 4: 111,822,829 Y428C possibly damaging Het
Tbc1d5 T C 17: 50,984,632 D47G probably benign Het
Trp53 T C 11: 69,588,740 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ttc39b T C 4: 83,261,847 D103G probably damaging Het
Ttn A C 2: 76,919,978 W3576G probably benign Het
Yeats2 T A 16: 20,154,162 M22K probably damaging Het
Other mutations in R3hdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:R3hdm4 APN 10 79912091 missense probably damaging 1.00
PIT4472001:R3hdm4 UTSW 10 79913555 critical splice donor site probably null
R0801:R3hdm4 UTSW 10 79913357 unclassified probably benign
R1167:R3hdm4 UTSW 10 79912073 critical splice donor site probably null
R3622:R3hdm4 UTSW 10 79912681 missense possibly damaging 0.96
R5264:R3hdm4 UTSW 10 79913341 missense probably benign 0.19
R5268:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5269:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5357:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5358:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5362:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5363:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5434:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5435:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5442:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5534:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5921:R3hdm4 UTSW 10 79913619 missense probably damaging 1.00
R6041:R3hdm4 UTSW 10 79913661 missense possibly damaging 0.46
R7391:R3hdm4 UTSW 10 79911109 missense probably benign 0.00
R7496:R3hdm4 UTSW 10 79916874 missense probably damaging 0.99
R7913:R3hdm4 UTSW 10 79911945 missense probably damaging 1.00
R7994:R3hdm4 UTSW 10 79911945 missense probably damaging 1.00
X0022:R3hdm4 UTSW 10 79913652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATTCATTTCCACTGCCCAG -3'
(R):5'- CGTTACTTGGAGGATGAGAGCC -3'

Sequencing Primer
(F):5'- AGTCCTCTCCTTCCTAACCACTG -3'
(R):5'- CCAGGGCAAGCGGAGAC -3'
Posted On2016-08-04