Mutagenetix > Incidental Mutations

Incidental Mutation 'R5360:Otx1'

424297

Institutional Source

Beutler Lab

Gene Symbol

Otx1

Ensembl Gene

ENSMUSG00000005917

Gene Name

orthodenticle homeobox 1

Synonyms

A730044F23Rik, jv

MMRRC Submission

042939-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R5360 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21994764-22002897 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 21997037 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 91 (A91S)

Ref Sequence

ENSEMBL: ENSMUSP00000134704 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006071] [ENSMUST00000147486]

Predicted Effect

probably damaging
Transcript: ENSMUST00000006071
AA Change: A91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006071
Gene: ENSMUSG00000005917
AA Change: A91S

Domain	Start	End	E-Value	Type
HOX	38	100	1.21e-25	SMART
low complexity region	117	125	N/A	INTRINSIC
Pfam:TF_Otx	178	279	2.5e-39	PFAM
internal_repeat_1	310	322	1.39e-7	PROSPERO
low complexity region	324	331	N/A	INTRINSIC
internal_repeat_1	334	346	1.39e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000147486
AA Change: A91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134704
Gene: ENSMUSG00000005917
AA Change: A91S

Domain	Start	End	E-Value	Type
HOX	38	100	1.21e-25	SMART
low complexity region	117	125	N/A	INTRINSIC
low complexity region	133	147	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172395

Meta Mutation Damage Score

0.4867

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the bicoid subfamily of the paired homeobox transcription factor family. The encoded protein is critical to the maintenance and regionalization of the forebrain and midbrain during development. It may also have important functions in sense organ development, pituitary function, and in the regulation of blood cell production. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inner ear abnormalities and circling/head-shaking behavior are seen in mild mutants; null mutants also have spontaneous seizures and defects in dorsal telencephalic cortex, mesencephalon, cerebellum and eye; and show delayed growth and sexual maturation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Acsl5	T	A	19: 55,291,160	Y443*	probably null	Het
Aox3	C	T	1: 58,146,508	T331M	probably damaging	Het
Arhgap32	G	A	9: 32,259,671	R1598H	probably damaging	Het
Atp1a2	A	G	1: 172,278,869		probably null	Het
Brpf3	A	T	17: 28,810,562	M499L	probably benign	Het
Cacnb1	A	T	11: 98,018,271		probably null	Het
Cep295	A	G	9: 15,326,733	S1899P	probably damaging	Het
Cntn2	A	G	1: 132,518,857	Y748H	probably damaging	Het
Csmd3	T	A	15: 47,669,203	Y2532F	probably damaging	Het
D17Wsu92e	A	T	17: 27,794,046	I59N	probably damaging	Het
Dsg1a	A	G	18: 20,340,954	D1028G	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gabra5	C	T	7: 57,490,785	G55R	probably damaging	Het
Gdf9	T	A	11: 53,437,207	F330Y	probably benign	Het
Gimap8	T	C	6: 48,656,302	S352P	probably damaging	Het
Gm4952	A	T	19: 12,623,629	H71L	probably benign	Het
Gm6803	A	C	12: 88,018,495	L93V	probably benign	Het
Gnaq	G	A	19: 16,133,426	R34H	probably benign	Het
Hebp2	T	C	10: 18,544,307	D126G	probably benign	Het
Hectd4	A	G	5: 121,315,401	D601G	possibly damaging	Het
Hook2	T	C	8: 85,001,404	Y577H	probably damaging	Het
Igfals	A	G	17: 24,880,093	T53A	probably benign	Het
Igsf9b	A	G	9: 27,311,672	D123G	probably damaging	Het
Ikbkap	A	T	4: 56,800,104	H7Q	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mdm4	A	T	1: 132,991,658	*490K	probably null	Het
Melk	C	T	4: 44,363,730	T592M	probably damaging	Het
Neurl2	C	A	2: 164,833,101	A114S	probably damaging	Het
Nuggc	A	G	14: 65,638,626	T563A	probably damaging	Het
Olfr951	T	G	9: 39,394,402	F204V	probably benign	Het
Pdlim1	A	T	19: 40,230,549	S213T	probably damaging	Het
Pitx1	T	C	13: 55,828,478	I123V	probably damaging	Het
Pkd1l1	T	C	11: 8,879,204	N1013D	probably benign	Het
Pla2g2c	T	A	4: 138,734,345	Y42N	possibly damaging	Het
Polr2b	G	A	5: 77,349,146	A1168T	possibly damaging	Het
Ppp2r2a	G	A	14: 67,016,571	R383*	probably null	Het
Prl7a2	C	T	13: 27,659,160	R220H	probably benign	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rc3h2	A	G	2: 37,389,855	V454A	possibly damaging	Het
Robo1	A	G	16: 72,935,777	T307A	probably damaging	Het
Slc22a6	T	C	19: 8,619,422	L188P	probably damaging	Het
Spag17	A	G	3: 100,109,410	N2167S	probably benign	Het
Spag5	G	A	11: 78,314,762	E680K	probably damaging	Het
Spata6	A	G	4: 111,822,829	Y428C	possibly damaging	Het
Tbc1d5	T	C	17: 50,984,632	D47G	probably benign	Het
Trp53	T	C	11: 69,588,740		probably null	Het
Tsc22d1	TCAGCAGCAGCAGCAGCAGCAGCAGCA	TCAGCAGCAGCAGCAGCAGCAGCA	14: 76,417,267		probably benign	Het
Ttc39b	T	C	4: 83,261,847	D103G	probably damaging	Het
Ttn	A	C	2: 76,919,978	W3576G	probably benign	Het
Yeats2	T	A	16: 20,154,162	M22K	probably damaging	Het

Other mutations in Otx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Otx1	APN	11	21996794	unclassified	probably benign
Embarrassed	UTSW	11	21997037	missense	probably damaging	1.00
R1946:Otx1	UTSW	11	21998482	missense	probably damaging	1.00
R2291:Otx1	UTSW	11	21996634	unclassified	probably benign
R2870:Otx1	UTSW	11	21998681	intron	probably benign
R4164:Otx1	UTSW	11	21996638	unclassified	probably benign
R4845:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R4925:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R4934:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R4993:Otx1	UTSW	11	21998532	splice site	probably null
R5061:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5062:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5063:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5068:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5069:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5070:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5097:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5169:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5170:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5171:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5172:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5198:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5199:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5200:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5201:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5202:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5203:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5204:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5205:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5256:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5267:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5361:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5363:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5372:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5375:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5380:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5381:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5382:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5383:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5415:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5416:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5534:Otx1	UTSW	11	21996296	unclassified	probably benign
R5592:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5594:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5725:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5727:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5735:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5736:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5841:Otx1	UTSW	11	21998594	intron	probably benign
R5940:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5941:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6080:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6081:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6093:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6126:Otx1	UTSW	11	21996457	unclassified	probably benign
R6131:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6132:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6134:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6187:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6220:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6269:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6270:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6271:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6272:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6396:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6619:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6624:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6680:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6681:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6718:Otx1	UTSW	11	21996412	unclassified	probably benign
R6831:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6834:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6985:Otx1	UTSW	11	21996615	nonsense	probably null
R7631:Otx1	UTSW	11	21999458	nonsense	probably null
X0054:Otx1	UTSW	11	21996331	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- CTCCAGATGGACGAAGCAGTAG -3'
(R):5'- TACTAGGGGTTTGCGCAGAAG -3'

Sequencing Primer
(F):5'- TCAGAGAGGACGCTGCTG -3'
(R):5'- TTTGCGCAGAAGGATGGG -3'

Posted On

2016-08-04