Mutagenetix > Incidental Mutation

Incidental Mutation 'R5360:Spag5'

424301

Institutional Source

Beutler Lab

Gene Symbol

Spag5

Ensembl Gene

ENSMUSG00000002055

Gene Name

sperm associated antigen 5

Synonyms

D11Bhm180e, Astrin, MAP126, Deepest, Mastrin, S17, s17

MMRRC Submission

042939-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5360 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78301529-78322457 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 78314762 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 680 (E680K)

Ref Sequence

ENSEMBL: ENSMUSP00000045286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045026]

AlphaFold

Q7TME2

Predicted Effect

probably damaging
Transcript: ENSMUST00000045026
AA Change: E680K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055
AA Change: E680K

Domain	Start	End	E-Value	Type
low complexity region	405	420	N/A	INTRINSIC
low complexity region	477	493	N/A	INTRINSIC
coiled coil region	514	547	N/A	INTRINSIC
coiled coil region	638	700	N/A	INTRINSIC
coiled coil region	743	854	N/A	INTRINSIC
low complexity region	898	912	N/A	INTRINSIC
coiled coil region	970	1006	N/A	INTRINSIC
coiled coil region	1032	1068	N/A	INTRINSIC
coiled coil region	1104	1140	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128359

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141026

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146068

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149711

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150016

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Acsl5	T	A	19: 55,291,160	Y443*	probably null	Het
Aox3	C	T	1: 58,146,508	T331M	probably damaging	Het
Arhgap32	G	A	9: 32,259,671	R1598H	probably damaging	Het
Atp1a2	A	G	1: 172,278,869		probably null	Het
Brpf3	A	T	17: 28,810,562	M499L	probably benign	Het
Cacnb1	A	T	11: 98,018,271		probably null	Het
Cep295	A	G	9: 15,326,733	S1899P	probably damaging	Het
Cntn2	A	G	1: 132,518,857	Y748H	probably damaging	Het
Csmd3	T	A	15: 47,669,203	Y2532F	probably damaging	Het
D17Wsu92e	A	T	17: 27,794,046	I59N	probably damaging	Het
Dsg1a	A	G	18: 20,340,954	D1028G	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gabra5	C	T	7: 57,490,785	G55R	probably damaging	Het
Gdf9	T	A	11: 53,437,207	F330Y	probably benign	Het
Gimap8	T	C	6: 48,656,302	S352P	probably damaging	Het
Gm4952	A	T	19: 12,623,629	H71L	probably benign	Het
Gm6803	A	C	12: 88,018,495	L93V	probably benign	Het
Gnaq	G	A	19: 16,133,426	R34H	probably benign	Het
Hebp2	T	C	10: 18,544,307	D126G	probably benign	Het
Hectd4	A	G	5: 121,315,401	D601G	possibly damaging	Het
Hook2	T	C	8: 85,001,404	Y577H	probably damaging	Het
Igfals	A	G	17: 24,880,093	T53A	probably benign	Het
Igsf9b	A	G	9: 27,311,672	D123G	probably damaging	Het
Ikbkap	A	T	4: 56,800,104	H7Q	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mdm4	A	T	1: 132,991,658	*490K	probably null	Het
Melk	C	T	4: 44,363,730	T592M	probably damaging	Het
Neurl2	C	A	2: 164,833,101	A114S	probably damaging	Het
Nuggc	A	G	14: 65,638,626	T563A	probably damaging	Het
Olfr951	T	G	9: 39,394,402	F204V	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pdlim1	A	T	19: 40,230,549	S213T	probably damaging	Het
Pitx1	T	C	13: 55,828,478	I123V	probably damaging	Het
Pkd1l1	T	C	11: 8,879,204	N1013D	probably benign	Het
Pla2g2c	T	A	4: 138,734,345	Y42N	possibly damaging	Het
Polr2b	G	A	5: 77,349,146	A1168T	possibly damaging	Het
Ppp2r2a	G	A	14: 67,016,571	R383*	probably null	Het
Prl7a2	C	T	13: 27,659,160	R220H	probably benign	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rc3h2	A	G	2: 37,389,855	V454A	possibly damaging	Het
Robo1	A	G	16: 72,935,777	T307A	probably damaging	Het
Slc22a6	T	C	19: 8,619,422	L188P	probably damaging	Het
Spag17	A	G	3: 100,109,410	N2167S	probably benign	Het
Spata6	A	G	4: 111,822,829	Y428C	possibly damaging	Het
Tbc1d5	T	C	17: 50,984,632	D47G	probably benign	Het
Trp53	T	C	11: 69,588,740		probably null	Het
Tsc22d1	TCAGCAGCAGCAGCAGCAGCAGCAGCA	TCAGCAGCAGCAGCAGCAGCAGCA	14: 76,417,267		probably benign	Het
Ttc39b	T	C	4: 83,261,847	D103G	probably damaging	Het
Ttn	A	C	2: 76,919,978	W3576G	probably benign	Het
Yeats2	T	A	16: 20,154,162	M22K	probably damaging	Het

Other mutations in Spag5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Spag5	APN	11	78304617	missense	possibly damaging	0.62
IGL01820:Spag5	APN	11	78304259	missense	probably benign	0.06
IGL02066:Spag5	APN	11	78304532	missense	probably benign
IGL02140:Spag5	APN	11	78315633	missense	possibly damaging	0.62
IGL02251:Spag5	APN	11	78320034	missense	probably damaging	1.00
IGL02452:Spag5	APN	11	78304623	missense	probably benign	0.08
IGL02658:Spag5	APN	11	78321331	nonsense	probably null
boyardee	UTSW	11	78313191	critical splice donor site	probably null
Franco	UTSW	11	78314182	nonsense	probably null
spaghetto	UTSW	11	78313379	nonsense	probably null
IGL02991:Spag5	UTSW	11	78314251	missense	probably damaging	0.99
R0477:Spag5	UTSW	11	78314198	missense	probably damaging	1.00
R0512:Spag5	UTSW	11	78319586	unclassified	probably benign
R0535:Spag5	UTSW	11	78304728	missense	probably benign	0.00
R0557:Spag5	UTSW	11	78314211	missense	probably damaging	0.99
R0584:Spag5	UTSW	11	78304095	missense	possibly damaging	0.49
R0666:Spag5	UTSW	11	78313396	missense	probably damaging	1.00
R0723:Spag5	UTSW	11	78319584	unclassified	probably benign
R1413:Spag5	UTSW	11	78305317	nonsense	probably null
R1680:Spag5	UTSW	11	78320616	missense	probably damaging	1.00
R1687:Spag5	UTSW	11	78304929	missense	probably benign	0.32
R1696:Spag5	UTSW	11	78321326	missense	probably damaging	1.00
R1831:Spag5	UTSW	11	78314256	missense	probably benign	0.08
R1866:Spag5	UTSW	11	78304455	missense	possibly damaging	0.62
R1918:Spag5	UTSW	11	78304176	missense	probably benign	0.01
R4004:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4005:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4222:Spag5	UTSW	11	78304511	missense	probably damaging	1.00
R4750:Spag5	UTSW	11	78320052	missense	probably benign	0.00
R4771:Spag5	UTSW	11	78304766	missense	probably damaging	1.00
R4928:Spag5	UTSW	11	78314373	missense	probably damaging	0.97
R5366:Spag5	UTSW	11	78320326	splice site	probably null
R5618:Spag5	UTSW	11	78304080	missense	probably benign	0.00
R5668:Spag5	UTSW	11	78304716	missense	possibly damaging	0.53
R5762:Spag5	UTSW	11	78304146	missense	probably benign	0.25
R5859:Spag5	UTSW	11	78313534	missense	probably benign	0.38
R6564:Spag5	UTSW	11	78315575	missense	probably damaging	1.00
R6571:Spag5	UTSW	11	78321269	missense	probably damaging	1.00
R6573:Spag5	UTSW	11	78314182	nonsense	probably null
R7074:Spag5	UTSW	11	78305042	critical splice donor site	probably null
R7091:Spag5	UTSW	11	78313191	critical splice donor site	probably null
R7332:Spag5	UTSW	11	78313379	nonsense	probably null
R8073:Spag5	UTSW	11	78301977	missense	probably benign	0.22
R8709:Spag5	UTSW	11	78301912	missense	probably benign
R8723:Spag5	UTSW	11	78321389	missense	probably damaging	1.00
R8976:Spag5	UTSW	11	78304587	missense	probably benign	0.01
R9053:Spag5	UTSW	11	78321749	missense	probably benign	0.14
R9142:Spag5	UTSW	11	78301997	missense	possibly damaging	0.56
Z1176:Spag5	UTSW	11	78314982	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CTGGGAGCAACTTCATTTTCTG -3'
(R):5'- AGCTGAGCCGAGAGATCTAG -3'

Sequencing Primer
(F):5'- GAGCAACTTCATTTTCTGCAGTG -3'
(R):5'- GTATCCTAATGACATCATGGTGGCC -3'

Posted On

2016-08-04