Incidental Mutation 'R5360:Cacnb1'
ID424303
Institutional Source Beutler Lab
Gene Symbol Cacnb1
Ensembl Gene ENSMUSG00000020882
Gene Namecalcium channel, voltage-dependent, beta 1 subunit
SynonymsCchb1, Cchlb1
MMRRC Submission 042939-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5360 (G1)
Quality Score194
Status Not validated
Chromosome11
Chromosomal Location98001508-98023034 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 98018271 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017552] [ENSMUST00000092736] [ENSMUST00000103144] [ENSMUST00000107561] [ENSMUST00000107561] [ENSMUST00000107562]
Predicted Effect probably benign
Transcript: ENSMUST00000017552
SMART Domains Protein: ENSMUSP00000017552
Gene: ENSMUSG00000020882

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 1.1e-26 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
GuKc 228 409 5.57e-41 SMART
low complexity region 412 443 N/A INTRINSIC
low complexity region 523 543 N/A INTRINSIC
low complexity region 549 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092736
SMART Domains Protein: ENSMUSP00000090412
Gene: ENSMUSG00000020882

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 4.7e-26 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
GuKc 273 454 5.57e-41 SMART
low complexity region 457 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103144
SMART Domains Protein: ENSMUSP00000099433
Gene: ENSMUSG00000020882

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 1.4e-25 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
GuKc 273 454 5.57e-41 SMART
low complexity region 457 488 N/A INTRINSIC
low complexity region 603 623 N/A INTRINSIC
low complexity region 629 637 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107561
SMART Domains Protein: ENSMUSP00000103186
Gene: ENSMUSG00000020882

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 11 52 8e-27 PFAM
SH3 56 120 2.98e-2 SMART
low complexity region 135 146 N/A INTRINSIC
low complexity region 172 187 N/A INTRINSIC
GuKc 226 407 5.57e-41 SMART
low complexity region 410 441 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107561
SMART Domains Protein: ENSMUSP00000103186
Gene: ENSMUSG00000020882

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 11 52 8e-27 PFAM
SH3 56 120 2.98e-2 SMART
low complexity region 135 146 N/A INTRINSIC
low complexity region 172 187 N/A INTRINSIC
GuKc 226 407 5.57e-41 SMART
low complexity region 410 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107562
SMART Domains Protein: ENSMUSP00000103187
Gene: ENSMUSG00000020882

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 4.2e-26 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
GuKc 228 409 5.57e-41 SMART
low complexity region 412 443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135462
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the calcium channel beta subunit family. It plays an important role in the calcium channel by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals have reduced muscle mass, thin limbs, a curved spine, and flexed necks and extremeties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Acsl5 T A 19: 55,291,160 Y443* probably null Het
Aox3 C T 1: 58,146,508 T331M probably damaging Het
Arhgap32 G A 9: 32,259,671 R1598H probably damaging Het
Atp1a2 A G 1: 172,278,869 probably null Het
Brpf3 A T 17: 28,810,562 M499L probably benign Het
Cep295 A G 9: 15,326,733 S1899P probably damaging Het
Cntn2 A G 1: 132,518,857 Y748H probably damaging Het
Csmd3 T A 15: 47,669,203 Y2532F probably damaging Het
D17Wsu92e A T 17: 27,794,046 I59N probably damaging Het
Dsg1a A G 18: 20,340,954 D1028G probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabra5 C T 7: 57,490,785 G55R probably damaging Het
Gdf9 T A 11: 53,437,207 F330Y probably benign Het
Gimap8 T C 6: 48,656,302 S352P probably damaging Het
Gm4952 A T 19: 12,623,629 H71L probably benign Het
Gm6803 A C 12: 88,018,495 L93V probably benign Het
Gnaq G A 19: 16,133,426 R34H probably benign Het
Hebp2 T C 10: 18,544,307 D126G probably benign Het
Hectd4 A G 5: 121,315,401 D601G possibly damaging Het
Hook2 T C 8: 85,001,404 Y577H probably damaging Het
Igfals A G 17: 24,880,093 T53A probably benign Het
Igsf9b A G 9: 27,311,672 D123G probably damaging Het
Ikbkap A T 4: 56,800,104 H7Q probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mdm4 A T 1: 132,991,658 *490K probably null Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Neurl2 C A 2: 164,833,101 A114S probably damaging Het
Nuggc A G 14: 65,638,626 T563A probably damaging Het
Olfr951 T G 9: 39,394,402 F204V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pdlim1 A T 19: 40,230,549 S213T probably damaging Het
Pitx1 T C 13: 55,828,478 I123V probably damaging Het
Pkd1l1 T C 11: 8,879,204 N1013D probably benign Het
Pla2g2c T A 4: 138,734,345 Y42N possibly damaging Het
Polr2b G A 5: 77,349,146 A1168T possibly damaging Het
Ppp2r2a G A 14: 67,016,571 R383* probably null Het
Prl7a2 C T 13: 27,659,160 R220H probably benign Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rc3h2 A G 2: 37,389,855 V454A possibly damaging Het
Robo1 A G 16: 72,935,777 T307A probably damaging Het
Slc22a6 T C 19: 8,619,422 L188P probably damaging Het
Spag17 A G 3: 100,109,410 N2167S probably benign Het
Spag5 G A 11: 78,314,762 E680K probably damaging Het
Spata6 A G 4: 111,822,829 Y428C possibly damaging Het
Tbc1d5 T C 17: 50,984,632 D47G probably benign Het
Trp53 T C 11: 69,588,740 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ttc39b T C 4: 83,261,847 D103G probably damaging Het
Ttn A C 2: 76,919,978 W3576G probably benign Het
Yeats2 T A 16: 20,154,162 M22K probably damaging Het
Other mutations in Cacnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Cacnb1 APN 11 98022364 missense possibly damaging 0.50
IGL02633:Cacnb1 APN 11 98022373 missense probably damaging 0.98
awkward UTSW 11 98005782 missense probably damaging 1.00
R1037:Cacnb1 UTSW 11 98005017 utr 3 prime probably benign
R2101:Cacnb1 UTSW 11 98005728 missense probably damaging 1.00
R2363:Cacnb1 UTSW 11 98012846 missense possibly damaging 0.87
R4159:Cacnb1 UTSW 11 98012274 missense probably damaging 1.00
R4942:Cacnb1 UTSW 11 98002983 missense probably damaging 1.00
R5653:Cacnb1 UTSW 11 98009279 critical splice donor site probably null
R6137:Cacnb1 UTSW 11 98005782 missense probably damaging 1.00
R7154:Cacnb1 UTSW 11 98005133 missense probably damaging 0.99
R7163:Cacnb1 UTSW 11 98012900 missense probably benign 0.20
R7800:Cacnb1 UTSW 11 98009295 missense possibly damaging 0.56
R7816:Cacnb1 UTSW 11 98005289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAACCCTCATTCTCCCTTG -3'
(R):5'- AGACCTTGCCACATCTCTGAG -3'

Sequencing Primer
(F):5'- TGCCCAGAGAGACAGAGACAC -3'
(R):5'- GAGCTAAATATACCCTAGCAGTTTGC -3'
Posted On2016-08-04