Incidental Mutation 'R5360:Prl7a2'
ID424305
Institutional Source Beutler Lab
Gene Symbol Prl7a2
Ensembl Gene ENSMUSG00000046899
Gene Nameprolactin family 7, subfamily a, member 2
SynonymsPLP-F, Prlpf
MMRRC Submission 042939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5360 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location27658584-27668036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27659160 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 220 (R220H)
Ref Sequence ENSEMBL: ENSMUSP00000006660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006660]
Predicted Effect probably benign
Transcript: ENSMUST00000006660
AA Change: R220H

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000006660
Gene: ENSMUSG00000046899
AA Change: R220H

DomainStartEndE-ValueType
Pfam:Hormone_1 17 244 6.9e-45 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Acsl5 T A 19: 55,291,160 Y443* probably null Het
Aox3 C T 1: 58,146,508 T331M probably damaging Het
Arhgap32 G A 9: 32,259,671 R1598H probably damaging Het
Atp1a2 A G 1: 172,278,869 probably null Het
Brpf3 A T 17: 28,810,562 M499L probably benign Het
Cacnb1 A T 11: 98,018,271 probably null Het
Cep295 A G 9: 15,326,733 S1899P probably damaging Het
Cntn2 A G 1: 132,518,857 Y748H probably damaging Het
Csmd3 T A 15: 47,669,203 Y2532F probably damaging Het
D17Wsu92e A T 17: 27,794,046 I59N probably damaging Het
Dsg1a A G 18: 20,340,954 D1028G probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabra5 C T 7: 57,490,785 G55R probably damaging Het
Gdf9 T A 11: 53,437,207 F330Y probably benign Het
Gimap8 T C 6: 48,656,302 S352P probably damaging Het
Gm4952 A T 19: 12,623,629 H71L probably benign Het
Gm6803 A C 12: 88,018,495 L93V probably benign Het
Gnaq G A 19: 16,133,426 R34H probably benign Het
Hebp2 T C 10: 18,544,307 D126G probably benign Het
Hectd4 A G 5: 121,315,401 D601G possibly damaging Het
Hook2 T C 8: 85,001,404 Y577H probably damaging Het
Igfals A G 17: 24,880,093 T53A probably benign Het
Igsf9b A G 9: 27,311,672 D123G probably damaging Het
Ikbkap A T 4: 56,800,104 H7Q probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mdm4 A T 1: 132,991,658 *490K probably null Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Neurl2 C A 2: 164,833,101 A114S probably damaging Het
Nuggc A G 14: 65,638,626 T563A probably damaging Het
Olfr951 T G 9: 39,394,402 F204V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pdlim1 A T 19: 40,230,549 S213T probably damaging Het
Pitx1 T C 13: 55,828,478 I123V probably damaging Het
Pkd1l1 T C 11: 8,879,204 N1013D probably benign Het
Pla2g2c T A 4: 138,734,345 Y42N possibly damaging Het
Polr2b G A 5: 77,349,146 A1168T possibly damaging Het
Ppp2r2a G A 14: 67,016,571 R383* probably null Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rc3h2 A G 2: 37,389,855 V454A possibly damaging Het
Robo1 A G 16: 72,935,777 T307A probably damaging Het
Slc22a6 T C 19: 8,619,422 L188P probably damaging Het
Spag17 A G 3: 100,109,410 N2167S probably benign Het
Spag5 G A 11: 78,314,762 E680K probably damaging Het
Spata6 A G 4: 111,822,829 Y428C possibly damaging Het
Tbc1d5 T C 17: 50,984,632 D47G probably benign Het
Trp53 T C 11: 69,588,740 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ttc39b T C 4: 83,261,847 D103G probably damaging Het
Ttn A C 2: 76,919,978 W3576G probably benign Het
Yeats2 T A 16: 20,154,162 M22K probably damaging Het
Other mutations in Prl7a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Prl7a2 APN 13 27659208 missense probably damaging 0.98
IGL02424:Prl7a2 APN 13 27667970 missense probably null 0.08
IGL02734:Prl7a2 APN 13 27659207 missense probably benign 0.38
IGL02823:Prl7a2 APN 13 27662751 missense possibly damaging 0.95
PIT4260001:Prl7a2 UTSW 13 27659276 nonsense probably null
R0733:Prl7a2 UTSW 13 27662688 missense probably damaging 1.00
R1371:Prl7a2 UTSW 13 27662767 missense probably benign 0.01
R1778:Prl7a2 UTSW 13 27659271 missense probably damaging 0.98
R1857:Prl7a2 UTSW 13 27659180 nonsense probably null
R2063:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2064:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2065:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2067:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2068:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2176:Prl7a2 UTSW 13 27659106 missense probably benign 0.10
R2213:Prl7a2 UTSW 13 27665068 missense probably benign 0.06
R4111:Prl7a2 UTSW 13 27665067 missense possibly damaging 0.96
R4459:Prl7a2 UTSW 13 27665996 missense probably benign 0.21
R4483:Prl7a2 UTSW 13 27660947 missense possibly damaging 0.80
R4722:Prl7a2 UTSW 13 27660875 missense probably damaging 1.00
R5778:Prl7a2 UTSW 13 27661000 nonsense probably null
R6667:Prl7a2 UTSW 13 27661041 missense probably benign 0.03
R7107:Prl7a2 UTSW 13 27659093 missense possibly damaging 0.89
R7600:Prl7a2 UTSW 13 27659281 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCAGTATCCCAATAGTCCCATCTAC -3'
(R):5'- AGGTTCACAGACTTATCACTTCTC -3'

Sequencing Primer
(F):5'- ATTTGTCTGTCATTCCTCTTAAAGC -3'
(R):5'- GGAAATGTGGAATACACCG -3'
Posted On2016-08-04