Mutagenetix > Incidental Mutation

Incidental Mutation 'R5360:Tsc22d1'

424310

Institutional Source

Beutler Lab

Gene Symbol

Tsc22d1

Ensembl Gene

ENSMUSG00000022010

Gene Name

TSC22 domain family, member 1

Synonyms

TSC-22, Tgfb1i4, Egr5

MMRRC Submission

042939-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.270) question?

Stock #

R5360 (G1)

Quality Score

115

Status

Not validated

Chromosome

Chromosomal Location

76414961-76507765 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

TCAGCAGCAGCAGCAGCAGCAGCAGCA to TCAGCAGCAGCAGCAGCAGCAGCA at 76417267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134792 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048371] [ENSMUST00000110888] [ENSMUST00000175984] [ENSMUST00000176581] [ENSMUST00000176886] [ENSMUST00000177471]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048371

SMART Domains

Protein: ENSMUSP00000044517
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	32	47	N/A	INTRINSIC
low complexity region	59	96	N/A	INTRINSIC
low complexity region	121	132	N/A	INTRINSIC
low complexity region	191	208	N/A	INTRINSIC
low complexity region	216	241	N/A	INTRINSIC
low complexity region	246	257	N/A	INTRINSIC
low complexity region	266	289	N/A	INTRINSIC
low complexity region	461	489	N/A	INTRINSIC
low complexity region	497	521	N/A	INTRINSIC
low complexity region	537	556	N/A	INTRINSIC
low complexity region	619	637	N/A	INTRINSIC
low complexity region	673	687	N/A	INTRINSIC
low complexity region	702	724	N/A	INTRINSIC
low complexity region	933	970	N/A	INTRINSIC
Pfam:TSC22	992	1048	7e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110888

SMART Domains

Protein: ENSMUSP00000106513
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	32	47	N/A	INTRINSIC
low complexity region	59	96	N/A	INTRINSIC
low complexity region	121	132	N/A	INTRINSIC
low complexity region	191	208	N/A	INTRINSIC
low complexity region	216	241	N/A	INTRINSIC
low complexity region	246	257	N/A	INTRINSIC
low complexity region	266	289	N/A	INTRINSIC
low complexity region	379	407	N/A	INTRINSIC
low complexity region	415	439	N/A	INTRINSIC
low complexity region	455	474	N/A	INTRINSIC
internal_repeat_1	502	536	8.43e-5	PROSPERO
low complexity region	537	555	N/A	INTRINSIC
low complexity region	591	605	N/A	INTRINSIC
low complexity region	620	642	N/A	INTRINSIC
internal_repeat_1	644	676	8.43e-5	PROSPERO
low complexity region	851	888	N/A	INTRINSIC
Pfam:TSC22	910	969	4.7e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175984

SMART Domains

Protein: ENSMUSP00000135307
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	77	114	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176581

SMART Domains

Protein: ENSMUSP00000135789
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	78	115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176886

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177333

Predicted Effect

probably benign
Transcript: ENSMUST00000177471

SMART Domains

Protein: ENSMUSP00000134792
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	18	55	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mcie homozygous for a null allele exhibit increased proliferation of bone marrow cells and decreased kidney and heart weights. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Acsl5	T	A	19: 55,291,160	Y443*	probably null	Het
Aox3	C	T	1: 58,146,508	T331M	probably damaging	Het
Arhgap32	G	A	9: 32,259,671	R1598H	probably damaging	Het
Atp1a2	A	G	1: 172,278,869		probably null	Het
Brpf3	A	T	17: 28,810,562	M499L	probably benign	Het
Cacnb1	A	T	11: 98,018,271		probably null	Het
Cep295	A	G	9: 15,326,733	S1899P	probably damaging	Het
Cntn2	A	G	1: 132,518,857	Y748H	probably damaging	Het
Csmd3	T	A	15: 47,669,203	Y2532F	probably damaging	Het
D17Wsu92e	A	T	17: 27,794,046	I59N	probably damaging	Het
Dsg1a	A	G	18: 20,340,954	D1028G	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gabra5	C	T	7: 57,490,785	G55R	probably damaging	Het
Gdf9	T	A	11: 53,437,207	F330Y	probably benign	Het
Gimap8	T	C	6: 48,656,302	S352P	probably damaging	Het
Gm4952	A	T	19: 12,623,629	H71L	probably benign	Het
Gm6803	A	C	12: 88,018,495	L93V	probably benign	Het
Gnaq	G	A	19: 16,133,426	R34H	probably benign	Het
Hebp2	T	C	10: 18,544,307	D126G	probably benign	Het
Hectd4	A	G	5: 121,315,401	D601G	possibly damaging	Het
Hook2	T	C	8: 85,001,404	Y577H	probably damaging	Het
Igfals	A	G	17: 24,880,093	T53A	probably benign	Het
Igsf9b	A	G	9: 27,311,672	D123G	probably damaging	Het
Ikbkap	A	T	4: 56,800,104	H7Q	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mdm4	A	T	1: 132,991,658	*490K	probably null	Het
Melk	C	T	4: 44,363,730	T592M	probably damaging	Het
Neurl2	C	A	2: 164,833,101	A114S	probably damaging	Het
Nuggc	A	G	14: 65,638,626	T563A	probably damaging	Het
Olfr951	T	G	9: 39,394,402	F204V	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pdlim1	A	T	19: 40,230,549	S213T	probably damaging	Het
Pitx1	T	C	13: 55,828,478	I123V	probably damaging	Het
Pkd1l1	T	C	11: 8,879,204	N1013D	probably benign	Het
Pla2g2c	T	A	4: 138,734,345	Y42N	possibly damaging	Het
Polr2b	G	A	5: 77,349,146	A1168T	possibly damaging	Het
Ppp2r2a	G	A	14: 67,016,571	R383*	probably null	Het
Prl7a2	C	T	13: 27,659,160	R220H	probably benign	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rc3h2	A	G	2: 37,389,855	V454A	possibly damaging	Het
Robo1	A	G	16: 72,935,777	T307A	probably damaging	Het
Slc22a6	T	C	19: 8,619,422	L188P	probably damaging	Het
Spag17	A	G	3: 100,109,410	N2167S	probably benign	Het
Spag5	G	A	11: 78,314,762	E680K	probably damaging	Het
Spata6	A	G	4: 111,822,829	Y428C	possibly damaging	Het
Tbc1d5	T	C	17: 50,984,632	D47G	probably benign	Het
Trp53	T	C	11: 69,588,740		probably null	Het
Ttc39b	T	C	4: 83,261,847	D103G	probably damaging	Het
Ttn	A	C	2: 76,919,978	W3576G	probably benign	Het
Yeats2	T	A	16: 20,154,162	M22K	probably damaging	Het

Other mutations in Tsc22d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Tsc22d1	APN	14	76418917	missense	probably damaging	0.99
IGL00515:Tsc22d1	APN	14	76418477	missense	probably damaging	0.99
IGL00703:Tsc22d1	APN	14	76504828	missense	possibly damaging	0.62
IGL00974:Tsc22d1	APN	14	76506442	missense	probably damaging	1.00
IGL01015:Tsc22d1	APN	14	76418741	missense	possibly damaging	0.66
IGL01515:Tsc22d1	APN	14	76505299	critical splice donor site	probably null
IGL02172:Tsc22d1	APN	14	76417692	missense	probably benign	0.04
IGL02307:Tsc22d1	APN	14	76416461	missense	probably damaging	0.99
IGL02553:Tsc22d1	APN	14	76417398	missense	possibly damaging	0.73
IGL02870:Tsc22d1	APN	14	76417617	missense	probably benign	0.42
IGL02989:Tsc22d1	APN	14	76418901	missense	probably benign	0.05
IGL03216:Tsc22d1	APN	14	76418637	missense	probably benign	0.02
R0127:Tsc22d1	UTSW	14	76418981	missense	possibly damaging	0.92
R0416:Tsc22d1	UTSW	14	76505303	splice site	probably benign
R0854:Tsc22d1	UTSW	14	76418201	nonsense	probably null
R0963:Tsc22d1	UTSW	14	76418599	missense	possibly damaging	0.92
R1370:Tsc22d1	UTSW	14	76437664	intron	probably benign
R1736:Tsc22d1	UTSW	14	76418357	missense	probably benign	0.08
R1751:Tsc22d1	UTSW	14	76418102	missense	probably damaging	0.98
R1760:Tsc22d1	UTSW	14	76416948	missense	possibly damaging	0.69
R1767:Tsc22d1	UTSW	14	76418102	missense	probably damaging	0.98
R2020:Tsc22d1	UTSW	14	76418333	missense	probably damaging	1.00
R2209:Tsc22d1	UTSW	14	76418740	missense	probably damaging	1.00
R2439:Tsc22d1	UTSW	14	76417267	unclassified	probably benign
R2471:Tsc22d1	UTSW	14	76418204	missense	probably benign	0.00
R3114:Tsc22d1	UTSW	14	76417337	missense	probably damaging	1.00
R3907:Tsc22d1	UTSW	14	76416543	missense	probably damaging	0.98
R3973:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3974:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3975:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3976:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R4292:Tsc22d1	UTSW	14	76418880	missense	probably benign	0.12
R4612:Tsc22d1	UTSW	14	76419005	missense	possibly damaging	0.66
R4806:Tsc22d1	UTSW	14	76416988	splice site	probably null
R4980:Tsc22d1	UTSW	14	76418256	missense	probably benign	0.02
R5068:Tsc22d1	UTSW	14	76418310	missense	probably benign	0.44
R5070:Tsc22d1	UTSW	14	76418310	missense	probably benign	0.44
R5239:Tsc22d1	UTSW	14	76418412	missense	probably damaging	0.99
R5400:Tsc22d1	UTSW	14	76417054	missense	probably benign	0.00
R5616:Tsc22d1	UTSW	14	76416217	unclassified	probably benign
R5726:Tsc22d1	UTSW	14	76505317	nonsense	probably null
R5934:Tsc22d1	UTSW	14	76418826	missense	possibly damaging	0.87
R6860:Tsc22d1	UTSW	14	76418292	missense	possibly damaging	0.73
R6904:Tsc22d1	UTSW	14	76506483	nonsense	probably null
R7016:Tsc22d1	UTSW	14	76417542	missense	probably damaging	1.00
R7274:Tsc22d1	UTSW	14	76416714	missense	probably damaging	0.98
R7482:Tsc22d1	UTSW	14	76418487	missense	probably benign	0.10
R7532:Tsc22d1	UTSW	14	76416046	unclassified	probably benign
R7536:Tsc22d1	UTSW	14	76504763	missense	probably benign	0.00
R7784:Tsc22d1	UTSW	14	76416701	nonsense	probably null
R8161:Tsc22d1	UTSW	14	76417020	missense	probably benign	0.02
R8405:Tsc22d1	UTSW	14	76418294	missense	probably damaging	1.00
R8963:Tsc22d1	UTSW	14	76418826	missense	probably benign	0.06
R9150:Tsc22d1	UTSW	14	76416616	missense	probably damaging	0.99
R9259:Tsc22d1	UTSW	14	76417044	missense	probably damaging	1.00
R9431:Tsc22d1	UTSW	14	76417267	unclassified	probably benign
R9439:Tsc22d1	UTSW	14	76506459	missense	probably damaging	0.99
R9614:Tsc22d1	UTSW	14	76416543	missense	probably damaging	0.98
R9708:Tsc22d1	UTSW	14	76417224	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CTGTGGGTAGTTTCAGTCCC -3'
(R):5'- CACCACTTTATTGACGGCCAC -3'

Sequencing Primer
(F):5'- TTTCAGTCCCAGTGTGACGAACAG -3'
(R):5'- ACGCCTTCTGTAGCTGGCAC -3'

Posted On

2016-08-04