Incidental Mutation 'R5360:Igfals'
ID424320
Institutional Source Beutler Lab
Gene Symbol Igfals
Ensembl Gene ENSMUSG00000046070
Gene Nameinsulin-like growth factor binding protein, acid labile subunit
SynonymsALS, Albs
MMRRC Submission 042939-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5360 (G1)
Quality Score165
Status Not validated
Chromosome17
Chromosomal Location24878770-24882008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24880093 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 53 (T53A)
Ref Sequence ENSEMBL: ENSMUSP00000060169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044252] [ENSMUST00000050714]
Predicted Effect probably benign
Transcript: ENSMUST00000044252
SMART Domains Protein: ENSMUSP00000049319
Gene: ENSMUSG00000039183

DomainStartEndE-ValueType
Pfam:ParA 16 267 3.2e-99 PFAM
Pfam:ArsA_ATPase 19 66 1.7e-8 PFAM
Pfam:AAA_31 19 79 1.5e-8 PFAM
Pfam:MipZ 19 155 2.1e-10 PFAM
Pfam:CbiA 21 199 2.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050714
AA Change: T53A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000060169
Gene: ENSMUSG00000046070
AA Change: T53A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 40 78 9.37e-10 SMART
LRR 77 96 1.62e1 SMART
LRR 97 120 1.41e1 SMART
LRR_TYP 121 144 6.78e-3 SMART
LRR 145 168 1.03e1 SMART
LRR_TYP 169 192 1.1e-2 SMART
LRR 193 216 2.17e-1 SMART
LRR_TYP 217 240 2.4e-3 SMART
LRR_TYP 241 264 1.82e-3 SMART
LRR 265 288 5.72e-1 SMART
LRR_TYP 289 312 6.23e-2 SMART
LRR_TYP 313 336 6.32e-3 SMART
LRR_TYP 337 360 2.2e-2 SMART
LRR 361 384 1.89e-1 SMART
LRR 385 408 3.87e1 SMART
LRR 409 432 2.67e-1 SMART
LRR_TYP 433 456 1.06e-4 SMART
LRR_TYP 457 480 6.78e-3 SMART
LRR 481 504 1.09e2 SMART
LRR 505 530 2.68e1 SMART
LRRCT 535 582 5.11e-8 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serum protein that binds insulin-like growth factors, increasing their half-life and their vascular localization. Production of the encoded protein, which contains twenty leucine-rich repeats, is stimulated by growth hormone. Defects in this gene are a cause of acid-labile subunit deficiency, which maifests itself in a delayed and slow puberty. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene gain weight more slowly after birth and display less growth in long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Acsl5 T A 19: 55,291,160 Y443* probably null Het
Aox3 C T 1: 58,146,508 T331M probably damaging Het
Arhgap32 G A 9: 32,259,671 R1598H probably damaging Het
Atp1a2 A G 1: 172,278,869 probably null Het
Brpf3 A T 17: 28,810,562 M499L probably benign Het
Cacnb1 A T 11: 98,018,271 probably null Het
Cep295 A G 9: 15,326,733 S1899P probably damaging Het
Cntn2 A G 1: 132,518,857 Y748H probably damaging Het
Csmd3 T A 15: 47,669,203 Y2532F probably damaging Het
D17Wsu92e A T 17: 27,794,046 I59N probably damaging Het
Dsg1a A G 18: 20,340,954 D1028G probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabra5 C T 7: 57,490,785 G55R probably damaging Het
Gdf9 T A 11: 53,437,207 F330Y probably benign Het
Gimap8 T C 6: 48,656,302 S352P probably damaging Het
Gm4952 A T 19: 12,623,629 H71L probably benign Het
Gm6803 A C 12: 88,018,495 L93V probably benign Het
Gnaq G A 19: 16,133,426 R34H probably benign Het
Hebp2 T C 10: 18,544,307 D126G probably benign Het
Hectd4 A G 5: 121,315,401 D601G possibly damaging Het
Hook2 T C 8: 85,001,404 Y577H probably damaging Het
Igsf9b A G 9: 27,311,672 D123G probably damaging Het
Ikbkap A T 4: 56,800,104 H7Q probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mdm4 A T 1: 132,991,658 *490K probably null Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Neurl2 C A 2: 164,833,101 A114S probably damaging Het
Nuggc A G 14: 65,638,626 T563A probably damaging Het
Olfr951 T G 9: 39,394,402 F204V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pdlim1 A T 19: 40,230,549 S213T probably damaging Het
Pitx1 T C 13: 55,828,478 I123V probably damaging Het
Pkd1l1 T C 11: 8,879,204 N1013D probably benign Het
Pla2g2c T A 4: 138,734,345 Y42N possibly damaging Het
Polr2b G A 5: 77,349,146 A1168T possibly damaging Het
Ppp2r2a G A 14: 67,016,571 R383* probably null Het
Prl7a2 C T 13: 27,659,160 R220H probably benign Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rc3h2 A G 2: 37,389,855 V454A possibly damaging Het
Robo1 A G 16: 72,935,777 T307A probably damaging Het
Slc22a6 T C 19: 8,619,422 L188P probably damaging Het
Spag17 A G 3: 100,109,410 N2167S probably benign Het
Spag5 G A 11: 78,314,762 E680K probably damaging Het
Spata6 A G 4: 111,822,829 Y428C possibly damaging Het
Tbc1d5 T C 17: 50,984,632 D47G probably benign Het
Trp53 T C 11: 69,588,740 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ttc39b T C 4: 83,261,847 D103G probably damaging Het
Ttn A C 2: 76,919,978 W3576G probably benign Het
Yeats2 T A 16: 20,154,162 M22K probably damaging Het
Other mutations in Igfals
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Igfals APN 17 24881660 missense probably benign 0.08
IGL01796:Igfals APN 17 24880082 missense probably damaging 0.96
IGL02448:Igfals APN 17 24880187 missense probably damaging 1.00
R1022:Igfals UTSW 17 24880483 missense probably damaging 0.99
R1024:Igfals UTSW 17 24880483 missense probably damaging 0.99
R1127:Igfals UTSW 17 24880481 missense probably damaging 1.00
R1653:Igfals UTSW 17 24881078 missense probably benign 0.00
R1827:Igfals UTSW 17 24880304 missense probably benign 0.20
R3872:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R3873:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R3874:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R4278:Igfals UTSW 17 24881217 missense probably benign 0.01
R5417:Igfals UTSW 17 24880316 missense probably damaging 1.00
R5654:Igfals UTSW 17 24881465 missense probably benign 0.23
R6261:Igfals UTSW 17 24881365 missense possibly damaging 0.88
R7061:Igfals UTSW 17 24880307 missense probably damaging 1.00
R7223:Igfals UTSW 17 24881234 missense probably damaging 1.00
R7484:Igfals UTSW 17 24879988 missense possibly damaging 0.95
R7699:Igfals UTSW 17 24880574 missense probably damaging 1.00
R7700:Igfals UTSW 17 24880574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGGGTTTGGTTCATATCCTG -3'
(R):5'- TAGAGATTCTGCAGGCCCAG -3'

Sequencing Primer
(F):5'- ATATCCTGGGGGCATCTCC -3'
(R):5'- TGGCTCCAGGCTCCTCAG -3'
Posted On2016-08-04