Incidental Mutation 'R5360:Brpf3'
ID424322
Institutional Source Beutler Lab
Gene Symbol Brpf3
Ensembl Gene ENSMUSG00000063952
Gene Namebromodomain and PHD finger containing, 3
Synonyms
MMRRC Submission 042939-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R5360 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28801090-28838546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28810562 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 499 (M499L)
Ref Sequence ENSEMBL: ENSMUSP00000004985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004985]
Predicted Effect probably benign
Transcript: ENSMUST00000004985
AA Change: M499L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004985
Gene: ENSMUSG00000063952
AA Change: M499L

DomainStartEndE-ValueType
Pfam:EPL1 48 194 8.4e-38 PFAM
PHD 214 260 7.07e-5 SMART
PHD 324 387 4.74e-6 SMART
low complexity region 405 436 N/A INTRINSIC
Blast:BROMO 491 534 7e-21 BLAST
low complexity region 558 577 N/A INTRINSIC
BROMO 586 694 4.93e-39 SMART
low complexity region 777 792 N/A INTRINSIC
low complexity region 813 823 N/A INTRINSIC
PWWP 1073 1156 2.07e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156029
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout does not result in any obvious neurological, behavioral, developmental, histological, hematological, survival or reproductive phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Acsl5 T A 19: 55,291,160 Y443* probably null Het
Aox3 C T 1: 58,146,508 T331M probably damaging Het
Arhgap32 G A 9: 32,259,671 R1598H probably damaging Het
Atp1a2 A G 1: 172,278,869 probably null Het
Cacnb1 A T 11: 98,018,271 probably null Het
Cep295 A G 9: 15,326,733 S1899P probably damaging Het
Cntn2 A G 1: 132,518,857 Y748H probably damaging Het
Csmd3 T A 15: 47,669,203 Y2532F probably damaging Het
D17Wsu92e A T 17: 27,794,046 I59N probably damaging Het
Dsg1a A G 18: 20,340,954 D1028G probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabra5 C T 7: 57,490,785 G55R probably damaging Het
Gdf9 T A 11: 53,437,207 F330Y probably benign Het
Gimap8 T C 6: 48,656,302 S352P probably damaging Het
Gm4952 A T 19: 12,623,629 H71L probably benign Het
Gm6803 A C 12: 88,018,495 L93V probably benign Het
Gnaq G A 19: 16,133,426 R34H probably benign Het
Hebp2 T C 10: 18,544,307 D126G probably benign Het
Hectd4 A G 5: 121,315,401 D601G possibly damaging Het
Hook2 T C 8: 85,001,404 Y577H probably damaging Het
Igfals A G 17: 24,880,093 T53A probably benign Het
Igsf9b A G 9: 27,311,672 D123G probably damaging Het
Ikbkap A T 4: 56,800,104 H7Q probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mdm4 A T 1: 132,991,658 *490K probably null Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Neurl2 C A 2: 164,833,101 A114S probably damaging Het
Nuggc A G 14: 65,638,626 T563A probably damaging Het
Olfr951 T G 9: 39,394,402 F204V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pdlim1 A T 19: 40,230,549 S213T probably damaging Het
Pitx1 T C 13: 55,828,478 I123V probably damaging Het
Pkd1l1 T C 11: 8,879,204 N1013D probably benign Het
Pla2g2c T A 4: 138,734,345 Y42N possibly damaging Het
Polr2b G A 5: 77,349,146 A1168T possibly damaging Het
Ppp2r2a G A 14: 67,016,571 R383* probably null Het
Prl7a2 C T 13: 27,659,160 R220H probably benign Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rc3h2 A G 2: 37,389,855 V454A possibly damaging Het
Robo1 A G 16: 72,935,777 T307A probably damaging Het
Slc22a6 T C 19: 8,619,422 L188P probably damaging Het
Spag17 A G 3: 100,109,410 N2167S probably benign Het
Spag5 G A 11: 78,314,762 E680K probably damaging Het
Spata6 A G 4: 111,822,829 Y428C possibly damaging Het
Tbc1d5 T C 17: 50,984,632 D47G probably benign Het
Trp53 T C 11: 69,588,740 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ttc39b T C 4: 83,261,847 D103G probably damaging Het
Ttn A C 2: 76,919,978 W3576G probably benign Het
Yeats2 T A 16: 20,154,162 M22K probably damaging Het
Other mutations in Brpf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Brpf3 APN 17 28836700 utr 3 prime probably benign
IGL01397:Brpf3 APN 17 28817632 missense probably benign 0.22
IGL01608:Brpf3 APN 17 28821517 missense probably benign 0.00
IGL02073:Brpf3 APN 17 28807396 missense probably benign
IGL02540:Brpf3 APN 17 28828354 missense probably damaging 1.00
IGL02838:Brpf3 APN 17 28835784 missense probably benign 0.19
IGL02888:Brpf3 APN 17 28828391 missense probably damaging 1.00
IGL02969:Brpf3 APN 17 28821305 missense probably benign 0.05
IGL03036:Brpf3 APN 17 28824048 missense possibly damaging 0.89
IGL03084:Brpf3 APN 17 28835777 missense probably damaging 0.98
R0448:Brpf3 UTSW 17 28806036 missense probably benign 0.10
R0898:Brpf3 UTSW 17 28806990 missense possibly damaging 0.65
R1268:Brpf3 UTSW 17 28836556 missense probably damaging 0.98
R1639:Brpf3 UTSW 17 28824068 critical splice donor site probably null
R1754:Brpf3 UTSW 17 28821323 missense probably benign 0.00
R1867:Brpf3 UTSW 17 28807368 missense probably benign
R1954:Brpf3 UTSW 17 28806559 missense probably benign
R2000:Brpf3 UTSW 17 28821557 missense probably benign 0.20
R2064:Brpf3 UTSW 17 28821364 missense probably benign
R2209:Brpf3 UTSW 17 28828420 missense probably damaging 0.98
R2413:Brpf3 UTSW 17 28805950 start gained probably benign
R3977:Brpf3 UTSW 17 28807042 missense possibly damaging 0.49
R4067:Brpf3 UTSW 17 28821259 missense probably benign
R4291:Brpf3 UTSW 17 28823975 missense probably benign 0.00
R4369:Brpf3 UTSW 17 28836620 missense probably damaging 1.00
R4371:Brpf3 UTSW 17 28836620 missense probably damaging 1.00
R4741:Brpf3 UTSW 17 28817784 missense possibly damaging 0.50
R4773:Brpf3 UTSW 17 28821259 missense probably benign 0.00
R4824:Brpf3 UTSW 17 28806486 missense probably benign
R5923:Brpf3 UTSW 17 28806636 missense possibly damaging 0.90
R6181:Brpf3 UTSW 17 28810581 missense probably damaging 1.00
R6278:Brpf3 UTSW 17 28821284 missense probably benign 0.00
R6702:Brpf3 UTSW 17 28810659 missense probably benign 0.01
R6884:Brpf3 UTSW 17 28831350 missense probably benign 0.03
R6920:Brpf3 UTSW 17 28823996 missense probably benign 0.34
R6976:Brpf3 UTSW 17 28835777 missense probably damaging 0.98
R7099:Brpf3 UTSW 17 28806637 missense probably benign 0.06
R7108:Brpf3 UTSW 17 28817125 missense probably benign 0.01
R7193:Brpf3 UTSW 17 28836691 makesense probably null
R7316:Brpf3 UTSW 17 28814686 missense probably damaging 1.00
R7326:Brpf3 UTSW 17 28806293 missense probably benign 0.00
R7403:Brpf3 UTSW 17 28821356 missense probably benign
R7666:Brpf3 UTSW 17 28810572 missense possibly damaging 0.83
R7686:Brpf3 UTSW 17 28806934 missense probably damaging 0.98
R7691:Brpf3 UTSW 17 28806831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAAGCTGAGACATTTGG -3'
(R):5'- ATTGGCAAAGGCTTCCTGGG -3'

Sequencing Primer
(F):5'- GACATTTGGTCACTTCCTTCTG -3'
(R):5'- TGGTGGCACCATCTCACGTC -3'
Posted On2016-08-04