Mutagenetix > Incidental Mutations

Incidental Mutation 'R5360:Acsl5'

424330

Institutional Source

Beutler Lab

Gene Symbol

Acsl5

Ensembl Gene

ENSMUSG00000024981

Gene Name

acyl-CoA synthetase long-chain family member 5

Synonyms

Facl5, 1700030F05Rik

MMRRC Submission

042939-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5360 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55251938-55297720 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 55291160 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 443 (Y443*)

Ref Sequence

ENSEMBL: ENSMUSP00000046585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043150] [ENSMUST00000225963] [ENSMUST00000226103]

Predicted Effect

probably null
Transcript: ENSMUST00000043150
AA Change: Y443*

SMART Domains

Protein: ENSMUSP00000046585
Gene: ENSMUSG00000024981
AA Change: Y443*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:AMP-binding	82	548	2.7e-112	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000224414

Predicted Effect

probably benign
Transcript: ENSMUST00000225963

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226019

Predicted Effect

probably benign
Transcript: ENSMUST00000226103

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in uterus and spleen, and in trace amounts in normal brain, but has markedly increased levels in malignant gliomas. This gene functions in mediating fatty acid-induced glioma cell growth. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit decreased mean bone mineral content and density measurements when compared with controls. A notably decreased mean platelet count is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Aox3	C	T	1: 58,146,508	T331M	probably damaging	Het
Arhgap32	G	A	9: 32,259,671	R1598H	probably damaging	Het
Atp1a2	A	G	1: 172,278,869		probably null	Het
Brpf3	A	T	17: 28,810,562	M499L	probably benign	Het
Cacnb1	A	T	11: 98,018,271		probably null	Het
Cep295	A	G	9: 15,326,733	S1899P	probably damaging	Het
Cntn2	A	G	1: 132,518,857	Y748H	probably damaging	Het
Csmd3	T	A	15: 47,669,203	Y2532F	probably damaging	Het
D17Wsu92e	A	T	17: 27,794,046	I59N	probably damaging	Het
Dsg1a	A	G	18: 20,340,954	D1028G	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gabra5	C	T	7: 57,490,785	G55R	probably damaging	Het
Gdf9	T	A	11: 53,437,207	F330Y	probably benign	Het
Gimap8	T	C	6: 48,656,302	S352P	probably damaging	Het
Gm4952	A	T	19: 12,623,629	H71L	probably benign	Het
Gm6803	A	C	12: 88,018,495	L93V	probably benign	Het
Gnaq	G	A	19: 16,133,426	R34H	probably benign	Het
Hebp2	T	C	10: 18,544,307	D126G	probably benign	Het
Hectd4	A	G	5: 121,315,401	D601G	possibly damaging	Het
Hook2	T	C	8: 85,001,404	Y577H	probably damaging	Het
Igfals	A	G	17: 24,880,093	T53A	probably benign	Het
Igsf9b	A	G	9: 27,311,672	D123G	probably damaging	Het
Ikbkap	A	T	4: 56,800,104	H7Q	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mdm4	A	T	1: 132,991,658	*490K	probably null	Het
Melk	C	T	4: 44,363,730	T592M	probably damaging	Het
Neurl2	C	A	2: 164,833,101	A114S	probably damaging	Het
Nuggc	A	G	14: 65,638,626	T563A	probably damaging	Het
Olfr951	T	G	9: 39,394,402	F204V	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pdlim1	A	T	19: 40,230,549	S213T	probably damaging	Het
Pitx1	T	C	13: 55,828,478	I123V	probably damaging	Het
Pkd1l1	T	C	11: 8,879,204	N1013D	probably benign	Het
Pla2g2c	T	A	4: 138,734,345	Y42N	possibly damaging	Het
Polr2b	G	A	5: 77,349,146	A1168T	possibly damaging	Het
Ppp2r2a	G	A	14: 67,016,571	R383*	probably null	Het
Prl7a2	C	T	13: 27,659,160	R220H	probably benign	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rc3h2	A	G	2: 37,389,855	V454A	possibly damaging	Het
Robo1	A	G	16: 72,935,777	T307A	probably damaging	Het
Slc22a6	T	C	19: 8,619,422	L188P	probably damaging	Het
Spag17	A	G	3: 100,109,410	N2167S	probably benign	Het
Spag5	G	A	11: 78,314,762	E680K	probably damaging	Het
Spata6	A	G	4: 111,822,829	Y428C	possibly damaging	Het
Tbc1d5	T	C	17: 50,984,632	D47G	probably benign	Het
Trp53	T	C	11: 69,588,740		probably null	Het
Tsc22d1	TCAGCAGCAGCAGCAGCAGCAGCAGCA	TCAGCAGCAGCAGCAGCAGCAGCA	14: 76,417,267		probably benign	Het
Ttc39b	T	C	4: 83,261,847	D103G	probably damaging	Het
Ttn	A	C	2: 76,919,978	W3576G	probably benign	Het
Yeats2	T	A	16: 20,154,162	M22K	probably damaging	Het

Other mutations in Acsl5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01618:Acsl5	APN	19	55272833	missense	probably benign	0.02
IGL02792:Acsl5	APN	19	55293731	critical splice donor site	probably null
lyrebird	UTSW	19	55272819	nonsense	probably null
paradise	UTSW	19	55278183	missense
sharkey	UTSW	19	55277973	critical splice donor site	probably null
IGL02796:Acsl5	UTSW	19	55278169	nonsense	probably null
R0206:Acsl5	UTSW	19	55280569	missense	probably benign
R0400:Acsl5	UTSW	19	55293711	missense	probably damaging	0.99
R0418:Acsl5	UTSW	19	55272806	missense	probably benign	0.16
R0571:Acsl5	UTSW	19	55288911	intron	probably benign
R0626:Acsl5	UTSW	19	55284472	missense	probably benign	0.00
R0792:Acsl5	UTSW	19	55280492	missense	probably benign	0.01
R1144:Acsl5	UTSW	19	55291843	missense	probably damaging	1.00
R1477:Acsl5	UTSW	19	55291472	missense	probably benign	0.23
R1522:Acsl5	UTSW	19	55280492	missense	probably benign	0.01
R1927:Acsl5	UTSW	19	55278154	missense	probably benign	0.37
R2495:Acsl5	UTSW	19	55293599	nonsense	probably null
R4153:Acsl5	UTSW	19	55281463	missense	probably benign	0.23
R4570:Acsl5	UTSW	19	55291774	missense	probably damaging	0.99
R4721:Acsl5	UTSW	19	55280530	missense	probably benign	0.00
R4834:Acsl5	UTSW	19	55280559	missense	probably benign	0.00
R5270:Acsl5	UTSW	19	55294218	missense	possibly damaging	0.50
R5436:Acsl5	UTSW	19	55279565	critical splice donor site	probably null
R5458:Acsl5	UTSW	19	55294230	missense	probably damaging	1.00
R5479:Acsl5	UTSW	19	55280462	missense	probably damaging	1.00
R5812:Acsl5	UTSW	19	55294836	missense	probably benign	0.01
R6232:Acsl5	UTSW	19	55280501	missense	possibly damaging	0.69
R6821:Acsl5	UTSW	19	55288836	missense	probably benign	0.03
R6874:Acsl5	UTSW	19	55291863	missense	probably damaging	1.00
R7030:Acsl5	UTSW	19	55272819	nonsense	probably null
R7156:Acsl5	UTSW	19	55268828	splice site	probably null
R7293:Acsl5	UTSW	19	55291210	missense	probably damaging	0.98
R7543:Acsl5	UTSW	19	55278183	missense
R7728:Acsl5	UTSW	19	55287853	nonsense	probably null
R7977:Acsl5	UTSW	19	55277973	critical splice donor site	probably null
R7987:Acsl5	UTSW	19	55277973	critical splice donor site	probably null
R8017:Acsl5	UTSW	19	55268796	missense	probably benign
R8221:Acsl5	UTSW	19	55268830	critical splice donor site	probably null
R8527:Acsl5	UTSW	19	55291827	missense	probably damaging	1.00
R8542:Acsl5	UTSW	19	55291827	missense	probably damaging	1.00
X0013:Acsl5	UTSW	19	55293664	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGGGTTAGCAACTATAGTACTCC -3'
(R):5'- AAAGCAAGACTTGAGTTTGCC -3'

Sequencing Primer
(F):5'- TGCTACACTGGCAGAGTTAC -3'
(R):5'- GCAAGACTTGAGTTTGCCATTTACC -3'

Posted On

2016-08-04