Incidental Mutation 'R5286:Vwa3b'
ID424331
Institutional Source Beutler Lab
Gene Symbol Vwa3b
Ensembl Gene ENSMUSG00000050122
Gene Namevon Willebrand factor A domain containing 3B
Synonyms4921511C04Rik, A230074B11Rik
MMRRC Submission 042870-MU
Accession Numbers

NCBI RefSeq: XM_003084438.1; MGI:1918103

Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5286 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location37026596-37187613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37045039 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 98 (W98R)
Ref Sequence ENSEMBL: ENSMUSP00000125460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027289] [ENSMUST00000067178] [ENSMUST00000117172] [ENSMUST00000124404] [ENSMUST00000162449]
AlphaFold A0A571BE33
Predicted Effect probably damaging
Transcript: ENSMUST00000027289
AA Change: W98R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027289
Gene: ENSMUSG00000050122
AA Change: W98R

DomainStartEndE-ValueType
Pfam:DUF4537 159 285 9.1e-36 PFAM
low complexity region 327 336 N/A INTRINSIC
low complexity region 345 364 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000067178
AA Change: W98R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069700
Gene: ENSMUSG00000050122
AA Change: W98R

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000117172
AA Change: W98R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114022
Gene: ENSMUSG00000050122
AA Change: W98R

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000124404
AA Change: W98R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141690
Gene: ENSMUSG00000050122
AA Change: W98R

DomainStartEndE-ValueType
Blast:VWA 112 272 5e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162449
AA Change: W98R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125460
Gene: ENSMUSG00000050122
AA Change: W98R

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Meta Mutation Damage Score 0.5372 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (64/64)
Allele List at MGI

All alleles(71) : Targeted(3) Gene trapped(68)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,295 I417V probably benign Het
Adad1 T C 3: 37,065,250 V160A possibly damaging Het
Adcy7 A G 8: 88,324,859 E869G probably damaging Het
Birc6 G A 17: 74,670,247 A4352T probably damaging Het
Brd2 T A 17: 34,115,231 T286S probably damaging Het
Bsn G T 9: 108,110,924 probably benign Het
Cables1 A G 18: 11,924,827 T335A probably benign Het
Cacna1d A T 14: 30,350,725 S98T possibly damaging Het
Ccdc181 A G 1: 164,278,241 Y15C probably damaging Het
Dlgap4 T G 2: 156,745,919 V39G probably damaging Het
Epb41l3 G A 17: 69,262,273 R504H probably benign Het
Fbxo7 T C 10: 86,022,090 L23P probably damaging Het
Gm42791 A C 5: 148,950,368 probably benign Het
Gprc5b A T 7: 118,983,687 F320I possibly damaging Het
Gtf3c1 G A 7: 125,663,408 T1093M possibly damaging Het
Hddc3 G T 7: 80,343,795 R83L probably damaging Het
Hspb11 T A 4: 107,279,801 I132N probably damaging Het
Iars2 T C 1: 185,323,121 probably benign Het
Igfn1 T C 1: 135,967,861 K1656E probably benign Het
Itk A C 11: 46,338,099 probably null Het
Klra6 G A 6: 130,018,969 T142I probably benign Het
Knop1 C T 7: 118,855,770 A3T probably damaging Het
Lamc3 A G 2: 31,918,596 H788R probably damaging Het
Lrif1 A G 3: 106,732,543 R315G probably damaging Het
Mfap3l A G 8: 60,656,869 D93G probably benign Het
Ngef T C 1: 87,545,830 S77G probably benign Het
Nt5dc3 T C 10: 86,804,792 S13P probably benign Het
Olfr12 T C 1: 92,620,362 V152A probably benign Het
Pclo T C 5: 14,679,747 probably benign Het
Pkhd1l1 C T 15: 44,514,972 Q1041* probably null Het
Ppl G A 16: 5,089,123 R1103* probably null Het
Ppp4r3b T A 11: 29,211,667 D680E probably benign Het
Rasgrf2 T G 13: 92,131,433 K21T possibly damaging Het
Rev1 T A 1: 38,055,326 K1004* probably null Het
Rgs9 T G 11: 109,239,451 probably null Het
Rnf31 T C 14: 55,592,236 L86P probably damaging Het
Rps13 A G 7: 116,333,920 Y18H probably damaging Het
Rxfp2 T C 5: 150,035,444 F33S probably damaging Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Stard9 T A 2: 120,701,947 V2895D probably benign Het
Syn3 T C 10: 86,351,564 N232S possibly damaging Het
Taok3 T A 5: 117,266,075 Y772N probably damaging Het
Tspan4 A G 7: 141,482,570 probably null Het
Ttn C A 2: 76,854,186 probably benign Het
Vwa5b2 A T 16: 20,596,308 D360V probably damaging Het
Wdr73 A T 7: 80,891,809 D328E probably benign Het
Xpo5 A G 17: 46,234,480 N824S probably benign Het
Zbtb2 C T 10: 4,368,566 G487S possibly damaging Het
Other mutations in Vwa3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Vwa3b APN 1 37154036 missense probably benign 0.28
IGL02236:Vwa3b APN 1 37154051 splice site probably benign
IGL02653:Vwa3b APN 1 37175565 utr 3 prime probably benign
IGL02823:Vwa3b APN 1 37186904 utr 3 prime probably benign
IGL03030:Vwa3b APN 1 37044968 missense probably damaging 1.00
P0014:Vwa3b UTSW 1 37173914 utr 3 prime probably benign
R0035:Vwa3b UTSW 1 37165689 missense possibly damaging 0.69
R0102:Vwa3b UTSW 1 37135514 missense probably damaging 1.00
R0556:Vwa3b UTSW 1 37164485 splice site probably benign
R1061:Vwa3b UTSW 1 37157430 missense probably damaging 1.00
R1386:Vwa3b UTSW 1 37051881 critical splice donor site probably null
R2441:Vwa3b UTSW 1 37143069 unclassified probably benign
R3117:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R3119:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R4081:Vwa3b UTSW 1 37035824 missense probably damaging 0.99
R4393:Vwa3b UTSW 1 37045178 missense probably damaging 1.00
R4897:Vwa3b UTSW 1 37114603 splice site probably benign
R4950:Vwa3b UTSW 1 37085332 missense probably benign 0.00
R4978:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5141:Vwa3b UTSW 1 37187021 utr 3 prime probably benign
R5356:Vwa3b UTSW 1 37114583 missense probably damaging 0.99
R5426:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5480:Vwa3b UTSW 1 37100706 nonsense probably null
R5727:Vwa3b UTSW 1 37135519 missense probably benign 0.10
R5876:Vwa3b UTSW 1 37076439 missense probably damaging 0.97
R6191:Vwa3b UTSW 1 37114531 missense possibly damaging 0.92
R6219:Vwa3b UTSW 1 37100698 missense possibly damaging 0.92
R6250:Vwa3b UTSW 1 37051885 splice site probably null
R6281:Vwa3b UTSW 1 37123982 missense probably damaging 1.00
R6419:Vwa3b UTSW 1 37157376 missense probably benign 0.01
R6467:Vwa3b UTSW 1 37085286 missense probably benign 0.01
R6512:Vwa3b UTSW 1 37063642 intron probably benign
R6541:Vwa3b UTSW 1 37051761 missense probably damaging 1.00
R6724:Vwa3b UTSW 1 37045031 missense probably damaging 1.00
R6728:Vwa3b UTSW 1 37157372 missense probably damaging 1.00
R7046:Vwa3b UTSW 1 37173878 missense probably benign
R7117:Vwa3b UTSW 1 37135553 missense
R7304:Vwa3b UTSW 1 37164505 missense probably damaging 1.00
R7402:Vwa3b UTSW 1 37114597 nonsense probably null
R7762:Vwa3b UTSW 1 37124045 missense probably damaging 1.00
R7911:Vwa3b UTSW 1 37154026 missense probably damaging 1.00
R8213:Vwa3b UTSW 1 37128939 missense probably benign 0.07
R8402:Vwa3b UTSW 1 37165798 missense probably damaging 1.00
R8697:Vwa3b UTSW 1 37076380 missense probably benign 0.09
R8758:Vwa3b UTSW 1 37137792 missense
R8874:Vwa3b UTSW 1 37035758 missense possibly damaging 0.73
R9011:Vwa3b UTSW 1 37115686 missense probably damaging 1.00
R9012:Vwa3b UTSW 1 37085310 missense probably benign 0.15
R9015:Vwa3b UTSW 1 37164516 missense possibly damaging 0.71
R9102:Vwa3b UTSW 1 37135512 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- CAGCTGTATCACCGGAACTG -3'
(R):5'- AGCCTAACTGTGTTAACTCGG -3'

Sequencing Primer
(F):5'- TGTATCACCGGAACTGAGGCC -3'
(R):5'- GCCTAACTGTGTTAACTCGGAAGATG -3'
Posted On2016-08-04