Incidental Mutation 'R5286:Wdr73'
ID 424354
Institutional Source Beutler Lab
Gene Symbol Wdr73
Ensembl Gene ENSMUSG00000025722
Gene Name WD repeat domain 73
Synonyms 2410008B13Rik, 1200011I23Rik
MMRRC Submission 042870-MU
Accession Numbers

Genbank: NM_028026; MGI: 1919218

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock # R5286 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 80890723-80901269 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80891809 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 328 (D328E)
Ref Sequence ENSEMBL: ENSMUSP00000026816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026816]
AlphaFold Q9CWR1
Predicted Effect probably benign
Transcript: ENSMUST00000026816
AA Change: D328E

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722
AA Change: D328E

DomainStartEndE-ValueType
WD40 67 112 8.52e1 SMART
Blast:WD40 162 204 3e-6 BLAST
Blast:WD40 208 254 3e-17 BLAST
WD40 263 304 2.57e0 SMART
WD40 314 364 8.91e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139990
Predicted Effect probably benign
Transcript: ENSMUST00000146402
SMART Domains Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722

DomainStartEndE-ValueType
Blast:WD40 66 111 3e-26 BLAST
Blast:WD40 182 228 4e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152518
Meta Mutation Damage Score 0.1047 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,295 I417V probably benign Het
Adad1 T C 3: 37,065,250 V160A possibly damaging Het
Adcy7 A G 8: 88,324,859 E869G probably damaging Het
Birc6 G A 17: 74,670,247 A4352T probably damaging Het
Brd2 T A 17: 34,115,231 T286S probably damaging Het
Bsn G T 9: 108,110,924 probably benign Het
Cables1 A G 18: 11,924,827 T335A probably benign Het
Cacna1d A T 14: 30,350,725 S98T possibly damaging Het
Ccdc181 A G 1: 164,278,241 Y15C probably damaging Het
Dlgap4 T G 2: 156,745,919 V39G probably damaging Het
Epb41l3 G A 17: 69,262,273 R504H probably benign Het
Fbxo7 T C 10: 86,022,090 L23P probably damaging Het
Gm42791 A C 5: 148,950,368 probably benign Het
Gprc5b A T 7: 118,983,687 F320I possibly damaging Het
Gtf3c1 G A 7: 125,663,408 T1093M possibly damaging Het
Hddc3 G T 7: 80,343,795 R83L probably damaging Het
Hspb11 T A 4: 107,279,801 I132N probably damaging Het
Iars2 T C 1: 185,323,121 probably benign Het
Igfn1 T C 1: 135,967,861 K1656E probably benign Het
Itk A C 11: 46,338,099 probably null Het
Klra6 G A 6: 130,018,969 T142I probably benign Het
Knop1 C T 7: 118,855,770 A3T probably damaging Het
Lamc3 A G 2: 31,918,596 H788R probably damaging Het
Lrif1 A G 3: 106,732,543 R315G probably damaging Het
Mfap3l A G 8: 60,656,869 D93G probably benign Het
Ngef T C 1: 87,545,830 S77G probably benign Het
Nt5dc3 T C 10: 86,804,792 S13P probably benign Het
Olfr12 T C 1: 92,620,362 V152A probably benign Het
Pclo T C 5: 14,679,747 probably benign Het
Pkhd1l1 C T 15: 44,514,972 Q1041* probably null Het
Ppl G A 16: 5,089,123 R1103* probably null Het
Ppp4r3b T A 11: 29,211,667 D680E probably benign Het
Rasgrf2 T G 13: 92,131,433 K21T possibly damaging Het
Rev1 T A 1: 38,055,326 K1004* probably null Het
Rgs9 T G 11: 109,239,451 probably null Het
Rnf31 T C 14: 55,592,236 L86P probably damaging Het
Rps13 A G 7: 116,333,920 Y18H probably damaging Het
Rxfp2 T C 5: 150,035,444 F33S probably damaging Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Stard9 T A 2: 120,701,947 V2895D probably benign Het
Syn3 T C 10: 86,351,564 N232S possibly damaging Het
Taok3 T A 5: 117,266,075 Y772N probably damaging Het
Tspan4 A G 7: 141,482,570 probably null Het
Ttn C A 2: 76,854,186 probably benign Het
Vwa3b T A 1: 37,045,039 W98R probably damaging Het
Vwa5b2 A T 16: 20,596,308 D360V probably damaging Het
Xpo5 A G 17: 46,234,480 N824S probably benign Het
Zbtb2 C T 10: 4,368,566 G487S possibly damaging Het
Other mutations in Wdr73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Wdr73 APN 7 80893663 missense probably benign 0.01
IGL02183:Wdr73 APN 7 80893760 missense probably damaging 1.00
IGL03253:Wdr73 APN 7 80897946 missense probably benign 0.00
3-1:Wdr73 UTSW 7 80897959 missense possibly damaging 0.91
R0469:Wdr73 UTSW 7 80897950 nonsense probably null
R0507:Wdr73 UTSW 7 80891846 missense possibly damaging 0.88
R0510:Wdr73 UTSW 7 80897950 nonsense probably null
R1349:Wdr73 UTSW 7 80893252 missense probably damaging 1.00
R1782:Wdr73 UTSW 7 80891778 missense probably damaging 1.00
R1917:Wdr73 UTSW 7 80893333 missense probably benign 0.17
R3085:Wdr73 UTSW 7 80901242 unclassified probably benign
R4478:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4479:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4480:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4910:Wdr73 UTSW 7 80891708 missense probably damaging 0.97
R4925:Wdr73 UTSW 7 80893195 missense probably benign 0.00
R5046:Wdr73 UTSW 7 80892425 unclassified probably benign
R5842:Wdr73 UTSW 7 80891710 missense probably damaging 1.00
R6991:Wdr73 UTSW 7 80891856 missense probably benign 0.17
R7182:Wdr73 UTSW 7 80893678 missense possibly damaging 0.45
R7197:Wdr73 UTSW 7 80893198 missense probably benign 0.02
R7362:Wdr73 UTSW 7 80900703 missense probably damaging 1.00
R7771:Wdr73 UTSW 7 80893227 missense probably benign 0.13
R8558:Wdr73 UTSW 7 80898506 missense probably damaging 1.00
R8950:Wdr73 UTSW 7 80900383 missense probably benign 0.00
X0022:Wdr73 UTSW 7 80897951 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CTATACACCTGGAGACGCAG -3'
(R):5'- AGTGTCTTGTGATAGAGGAAGTCC -3'

Sequencing Primer
(F):5'- TCCTAGAGGCAATGGTCGCTTC -3'
(R):5'- TCCTCCAAGGAAGAGTAGGGTCAC -3'
Posted On 2016-08-04