Incidental Mutation 'R5286:Bsn'
ID424361
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
MMRRC Submission 042870-MU
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R5286 (G1)
Quality Score114
Status Validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 108110924 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect unknown
Transcript: ENSMUST00000035208
AA Change: A2543D
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: A2543D

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124763
Meta Mutation Damage Score 0.1410 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,295 I417V probably benign Het
Adad1 T C 3: 37,065,250 V160A possibly damaging Het
Adcy7 A G 8: 88,324,859 E869G probably damaging Het
Birc6 G A 17: 74,670,247 A4352T probably damaging Het
Brd2 T A 17: 34,115,231 T286S probably damaging Het
Cables1 A G 18: 11,924,827 T335A probably benign Het
Cacna1d A T 14: 30,350,725 S98T possibly damaging Het
Ccdc181 A G 1: 164,278,241 Y15C probably damaging Het
Dlgap4 T G 2: 156,745,919 V39G probably damaging Het
Epb41l3 G A 17: 69,262,273 R504H probably benign Het
Fbxo7 T C 10: 86,022,090 L23P probably damaging Het
Gm42791 A C 5: 148,950,368 probably benign Het
Gprc5b A T 7: 118,983,687 F320I possibly damaging Het
Gtf3c1 G A 7: 125,663,408 T1093M possibly damaging Het
Hddc3 G T 7: 80,343,795 R83L probably damaging Het
Hspb11 T A 4: 107,279,801 I132N probably damaging Het
Iars2 T C 1: 185,323,121 probably benign Het
Igfn1 T C 1: 135,967,861 K1656E probably benign Het
Itk A C 11: 46,338,099 probably null Het
Klra6 G A 6: 130,018,969 T142I probably benign Het
Knop1 C T 7: 118,855,770 A3T probably damaging Het
Lamc3 A G 2: 31,918,596 H788R probably damaging Het
Lrif1 A G 3: 106,732,543 R315G probably damaging Het
Mfap3l A G 8: 60,656,869 D93G probably benign Het
Ngef T C 1: 87,545,830 S77G probably benign Het
Nt5dc3 T C 10: 86,804,792 S13P probably benign Het
Olfr12 T C 1: 92,620,362 V152A probably benign Het
Pclo T C 5: 14,679,747 probably benign Het
Pkhd1l1 C T 15: 44,514,972 Q1041* probably null Het
Ppl G A 16: 5,089,123 R1103* probably null Het
Ppp4r3b T A 11: 29,211,667 D680E probably benign Het
Rasgrf2 T G 13: 92,131,433 K21T possibly damaging Het
Rev1 T A 1: 38,055,326 K1004* probably null Het
Rgs9 T G 11: 109,239,451 probably null Het
Rnf31 T C 14: 55,592,236 L86P probably damaging Het
Rps13 A G 7: 116,333,920 Y18H probably damaging Het
Rxfp2 T C 5: 150,035,444 F33S probably damaging Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Stard9 T A 2: 120,701,947 V2895D probably benign Het
Syn3 T C 10: 86,351,564 N232S possibly damaging Het
Taok3 T A 5: 117,266,075 Y772N probably damaging Het
Tspan4 A G 7: 141,482,570 probably null Het
Ttn C A 2: 76,854,186 probably benign Het
Vwa3b T A 1: 37,045,039 W98R probably damaging Het
Vwa5b2 A T 16: 20,596,308 D360V probably damaging Het
Wdr73 A T 7: 80,891,809 D328E probably benign Het
Xpo5 A G 17: 46,234,480 N824S probably benign Het
Zbtb2 C T 10: 4,368,566 G487S possibly damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
R7868:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7897:Bsn UTSW 9 108111866 missense probably damaging 0.98
R7951:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7980:Bsn UTSW 9 108111866 missense probably damaging 0.98
R8022:Bsn UTSW 9 108114404 missense probably benign 0.01
R8056:Bsn UTSW 9 108105307 missense
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Z1177:Bsn UTSW 9 108105499 missense
Z1177:Bsn UTSW 9 108139195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATCTGTCTGCACACTGC -3'
(R):5'- ACTAGAGCAGATCCAGCAACTG -3'

Sequencing Primer
(F):5'- CTGCGAGTCACAAGGTAGC -3'
(R):5'- AGAAGGCCCCCTTTCCTG -3'
Posted On2016-08-04