Incidental Mutation 'R5286:Rasgrf2'
ID 424371
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene Name RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms Grf2, 6330417G04Rik
MMRRC Submission 042870-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.191) question?
Stock # R5286 (G1)
Quality Score 165
Status Validated
Chromosome 13
Chromosomal Location 92028519-92268164 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 92267941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 21 (K21T)
Ref Sequence ENSEMBL: ENSMUSP00000149731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000146492] [ENSMUST00000216219]
AlphaFold P70392
Predicted Effect possibly damaging
Transcript: ENSMUST00000099326
AA Change: K21T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: K21T

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146492
AA Change: K21T

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116203
Gene: ENSMUSG00000021708
AA Change: K21T

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
Pfam:RhoGEF 247 387 1.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216219
AA Change: K21T

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.0793 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,742,358 (GRCm39) I417V probably benign Het
Adad1 T C 3: 37,119,399 (GRCm39) V160A possibly damaging Het
Adcy7 A G 8: 89,051,487 (GRCm39) E869G probably damaging Het
Birc6 G A 17: 74,977,242 (GRCm39) A4352T probably damaging Het
Brd2 T A 17: 34,334,205 (GRCm39) T286S probably damaging Het
Bsn G T 9: 107,988,123 (GRCm39) probably benign Het
Cables1 A G 18: 12,057,884 (GRCm39) T335A probably benign Het
Cacna1d A T 14: 30,072,682 (GRCm39) S98T possibly damaging Het
Ccdc181 A G 1: 164,105,810 (GRCm39) Y15C probably damaging Het
Dlgap4 T G 2: 156,587,839 (GRCm39) V39G probably damaging Het
Epb41l3 G A 17: 69,569,268 (GRCm39) R504H probably benign Het
Fbxo7 T C 10: 85,857,954 (GRCm39) L23P probably damaging Het
Gm42791 A C 5: 148,887,178 (GRCm39) probably benign Het
Gprc5b A T 7: 118,582,910 (GRCm39) F320I possibly damaging Het
Gtf3c1 G A 7: 125,262,580 (GRCm39) T1093M possibly damaging Het
Hddc3 G T 7: 79,993,543 (GRCm39) R83L probably damaging Het
Iars2 T C 1: 185,055,318 (GRCm39) probably benign Het
Ift25 T A 4: 107,136,998 (GRCm39) I132N probably damaging Het
Igfn1 T C 1: 135,895,599 (GRCm39) K1656E probably benign Het
Itk A C 11: 46,228,926 (GRCm39) probably null Het
Klra6 G A 6: 129,995,932 (GRCm39) T142I probably benign Het
Knop1 C T 7: 118,454,993 (GRCm39) A3T probably damaging Het
Lamc3 A G 2: 31,808,608 (GRCm39) H788R probably damaging Het
Lrif1 A G 3: 106,639,859 (GRCm39) R315G probably damaging Het
Mfap3l A G 8: 61,109,903 (GRCm39) D93G probably benign Het
Ngef T C 1: 87,473,552 (GRCm39) S77G probably benign Het
Nt5dc3 T C 10: 86,640,656 (GRCm39) S13P probably benign Het
Or9s13 T C 1: 92,548,084 (GRCm39) V152A probably benign Het
Pclo T C 5: 14,729,761 (GRCm39) probably benign Het
Pkhd1l1 C T 15: 44,378,368 (GRCm39) Q1041* probably null Het
Ppl G A 16: 4,906,987 (GRCm39) R1103* probably null Het
Ppp4r3b T A 11: 29,161,667 (GRCm39) D680E probably benign Het
Rev1 T A 1: 38,094,407 (GRCm39) K1004* probably null Het
Rgs9 T G 11: 109,130,277 (GRCm39) probably null Het
Rnf31 T C 14: 55,829,693 (GRCm39) L86P probably damaging Het
Rps13 A G 7: 115,933,155 (GRCm39) Y18H probably damaging Het
Rxfp2 T C 5: 149,958,909 (GRCm39) F33S probably damaging Het
Sfmbt1 G A 14: 30,538,777 (GRCm39) V799M probably damaging Het
Stard9 T A 2: 120,532,428 (GRCm39) V2895D probably benign Het
Syn3 T C 10: 86,187,428 (GRCm39) N232S possibly damaging Het
Taok3 T A 5: 117,404,140 (GRCm39) Y772N probably damaging Het
Tspan4 A G 7: 141,062,483 (GRCm39) probably null Het
Ttn C A 2: 76,684,530 (GRCm39) probably benign Het
Vwa3b T A 1: 37,084,120 (GRCm39) W98R probably damaging Het
Vwa5b2 A T 16: 20,415,058 (GRCm39) D360V probably damaging Het
Wdr73 A T 7: 80,541,557 (GRCm39) D328E probably benign Het
Xpo5 A G 17: 46,545,406 (GRCm39) N824S probably benign Het
Zbtb2 C T 10: 4,318,566 (GRCm39) G487S possibly damaging Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92,159,425 (GRCm39) splice site probably benign
IGL01358:Rasgrf2 APN 13 92,130,749 (GRCm39) missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92,174,718 (GRCm39) missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 92,130,857 (GRCm39) missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 92,136,145 (GRCm39) missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92,267,900 (GRCm39) missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92,167,273 (GRCm39) missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 92,131,752 (GRCm39) missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92,159,413 (GRCm39) missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 92,136,098 (GRCm39) missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 92,044,170 (GRCm39) missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 92,067,936 (GRCm39) splice site probably benign
R0632:Rasgrf2 UTSW 13 92,120,393 (GRCm39) missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 92,130,890 (GRCm39) missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92,165,174 (GRCm39) missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 92,035,808 (GRCm39) missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92,167,396 (GRCm39) missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 92,131,795 (GRCm39) missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 92,044,205 (GRCm39) missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 92,038,783 (GRCm39) missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 92,050,740 (GRCm39) missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 92,117,149 (GRCm39) missense probably benign
R1934:Rasgrf2 UTSW 13 92,131,825 (GRCm39) splice site probably null
R1990:Rasgrf2 UTSW 13 92,172,473 (GRCm39) missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 92,050,748 (GRCm39) missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92,167,351 (GRCm39) missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 92,120,374 (GRCm39) missense probably benign
R2193:Rasgrf2 UTSW 13 92,160,221 (GRCm39) splice site probably null
R2406:Rasgrf2 UTSW 13 92,120,359 (GRCm39) missense probably benign
R3055:Rasgrf2 UTSW 13 92,165,583 (GRCm39) missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92,167,296 (GRCm39) missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 92,130,773 (GRCm39) missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 92,033,773 (GRCm39) nonsense probably null
R4576:Rasgrf2 UTSW 13 92,044,529 (GRCm39) missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92,174,789 (GRCm39) missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 92,138,716 (GRCm39) critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 92,131,780 (GRCm39) missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 92,136,135 (GRCm39) missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92,160,190 (GRCm39) missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 92,044,155 (GRCm39) missense probably damaging 1.00
R5902:Rasgrf2 UTSW 13 92,068,011 (GRCm39) missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92,165,609 (GRCm39) missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92,167,293 (GRCm39) missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92,267,954 (GRCm39) missense probably benign
R6428:Rasgrf2 UTSW 13 92,136,100 (GRCm39) missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92,167,361 (GRCm39) missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92,165,027 (GRCm39) missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 92,033,754 (GRCm39) missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 92,131,732 (GRCm39) missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 92,130,952 (GRCm39) missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92,159,100 (GRCm39) intron probably benign
R7056:Rasgrf2 UTSW 13 92,167,203 (GRCm39) missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 92,034,521 (GRCm39) missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 92,032,637 (GRCm39) nonsense probably null
R7392:Rasgrf2 UTSW 13 92,041,856 (GRCm39) missense
R7469:Rasgrf2 UTSW 13 92,165,530 (GRCm39) critical splice donor site probably null
R7618:Rasgrf2 UTSW 13 92,136,085 (GRCm39) missense
R7641:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7674:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7784:Rasgrf2 UTSW 13 92,044,201 (GRCm39) missense
R7962:Rasgrf2 UTSW 13 92,167,300 (GRCm39) missense probably damaging 0.99
R8056:Rasgrf2 UTSW 13 92,167,321 (GRCm39) missense probably damaging 0.97
R8218:Rasgrf2 UTSW 13 92,130,796 (GRCm39) missense
R8796:Rasgrf2 UTSW 13 92,038,685 (GRCm39) missense
R8913:Rasgrf2 UTSW 13 92,159,034 (GRCm39) missense probably benign 0.05
R8971:Rasgrf2 UTSW 13 92,158,225 (GRCm39) missense possibly damaging 0.80
R9020:Rasgrf2 UTSW 13 92,165,146 (GRCm39) missense possibly damaging 0.93
R9487:Rasgrf2 UTSW 13 92,267,759 (GRCm39) missense probably benign
R9562:Rasgrf2 UTSW 13 92,034,469 (GRCm39) critical splice donor site probably null
R9712:Rasgrf2 UTSW 13 92,136,092 (GRCm39) missense
R9766:Rasgrf2 UTSW 13 92,160,188 (GRCm39) missense probably damaging 1.00
R9800:Rasgrf2 UTSW 13 92,267,860 (GRCm39) missense probably damaging 0.99
X0013:Rasgrf2 UTSW 13 92,167,363 (GRCm39) missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 92,050,654 (GRCm39) missense probably damaging 0.99
Z1177:Rasgrf2 UTSW 13 92,159,081 (GRCm39) missense unknown
Z1177:Rasgrf2 UTSW 13 92,131,632 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGGTACCTGCTTGTCCAAAG -3'
(R):5'- TACTTCGGGTGGAGTGACACTG -3'

Sequencing Primer
(F):5'- TTGTCCAAAGCGTCCCG -3'
(R):5'- ATAGGCGCCCTAGGTCTG -3'
Posted On 2016-08-04