Incidental Mutation 'R0491:Arfgef1'
ID42439
Institutional Source Beutler Lab
Gene Symbol Arfgef1
Ensembl Gene ENSMUSG00000067851
Gene NameADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)
SynonymsP200, ARFGEP1, BIG1, D130059B05Rik, D730028O18Rik
MMRRC Submission 038689-MU
Accession Numbers

Genbank: NM_001102430.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0491 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location10137571-10232670 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 10179987 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088615] [ENSMUST00000131556]
Predicted Effect probably benign
Transcript: ENSMUST00000088615
SMART Domains Protein: ENSMUSP00000085986
Gene: ENSMUSG00000067851

DomainStartEndE-ValueType
Pfam:DCB 28 213 5.2e-45 PFAM
low complexity region 221 233 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 416 575 1.3e-52 PFAM
Blast:Sec7 588 637 6e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 6e-13 BLAST
Blast:Sec7 947 986 8e-18 BLAST
Pfam:DUF1981 1217 1300 3.6e-39 PFAM
low complexity region 1587 1602 N/A INTRINSIC
low complexity region 1777 1782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131556
SMART Domains Protein: ENSMUSP00000118805
Gene: ENSMUSG00000067851

DomainStartEndE-ValueType
coiled coil region 207 234 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 413 576 3.1e-59 PFAM
Blast:Sec7 588 637 2e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 3e-13 BLAST
Blast:Sec7 947 986 2e-18 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP. It contains a Sec7 domain, which may be responsible for guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, absent gastric milk and decreased brain size with increased neuron apoptosis, abnormal axon guidance and hypersensitivity to glutamate. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,182,243 S356T probably damaging Het
Abca13 T C 11: 9,298,235 F2661L probably benign Het
Acadsb A G 7: 131,430,107 D224G probably benign Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts2 A G 11: 50,776,630 D465G probably damaging Het
Akap9 A T 5: 3,972,851 probably benign Het
Alms1 A G 6: 85,702,600 T3240A probably damaging Het
Ap3d1 A G 10: 80,719,241 W417R probably damaging Het
Atf6 A G 1: 170,787,344 probably null Het
Cacna1s T A 1: 136,089,008 probably benign Het
Clcn1 T C 6: 42,310,581 F740L probably benign Het
Clec12a T A 6: 129,364,053 D265E probably benign Het
Clic3 T A 2: 25,457,785 probably benign Het
Cntnap3 T G 13: 64,762,045 T749P probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Crxos T A 7: 15,898,535 S89T probably benign Het
Cxcr1 G T 1: 74,192,309 P185T possibly damaging Het
Cyp20a1 T A 1: 60,371,327 N262K possibly damaging Het
Dpy19l2 T C 9: 24,696,028 R46G probably benign Het
Dpysl2 A T 14: 66,807,962 L454Q probably damaging Het
Dvl3 C T 16: 20,527,423 probably benign Het
Eppin T A 2: 164,589,412 E98V possibly damaging Het
Fancm A T 12: 65,106,061 H1097L probably benign Het
Fkbp4 A G 6: 128,435,742 I75T probably damaging Het
Fmn2 A G 1: 174,581,959 H586R unknown Het
Gm973 C T 1: 59,558,234 probably benign Het
Haus6 A C 4: 86,602,846 V185G possibly damaging Het
Herc2 T A 7: 56,122,366 C1098S possibly damaging Het
Hic1 C A 11: 75,166,310 L584F possibly damaging Het
Itgb1bp1 C A 12: 21,276,895 probably benign Het
Kbtbd2 G A 6: 56,780,389 R121* probably null Het
Lgr4 C T 2: 110,007,281 probably benign Het
Lrrc55 T C 2: 85,191,920 E309G probably damaging Het
Mertk T C 2: 128,793,107 probably null Het
Micu3 A G 8: 40,366,253 probably benign Het
Mmp11 G A 10: 75,926,758 A287V probably benign Het
Mpzl2 A G 9: 45,042,741 Y47C probably damaging Het
Muc5b A C 7: 141,862,015 R2899S probably benign Het
Myo1b A G 1: 51,755,698 Y1078H probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Ncapd3 T G 9: 27,057,883 V611G probably damaging Het
Ntpcr C T 8: 125,737,354 R73* probably null Het
Olfr1225 A T 2: 89,170,360 V284E probably benign Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Osbp2 A G 11: 3,714,709 F88S probably damaging Het
Pkn3 A T 2: 30,089,877 T711S probably damaging Het
Plekhm1 T C 11: 103,394,776 K278E probably benign Het
Ppp1r36 A G 12: 76,439,291 T408A probably benign Het
Prss41 T C 17: 23,842,503 T105A possibly damaging Het
Psme1 G T 14: 55,579,921 probably benign Het
Ptprq A T 10: 107,608,175 Y1523N probably damaging Het
Ric8b A G 10: 84,992,222 D470G probably damaging Het
Scarb1 A G 5: 125,298,731 probably benign Het
Slc25a54 G A 3: 109,102,796 A204T probably damaging Het
Spink10 T C 18: 62,659,965 C67R probably damaging Het
St5 T A 7: 109,557,204 Q113L probably benign Het
Tmtc1 A T 6: 148,412,640 probably null Het
Tprkb A G 6: 85,924,464 D28G probably benign Het
Ttll13 A G 7: 80,260,350 H747R probably benign Het
Usp24 A G 4: 106,402,105 S1608G probably benign Het
Utp20 A T 10: 88,760,912 F2115L probably damaging Het
Vmn1r200 A T 13: 22,395,191 I46L probably benign Het
Zdhhc8 A T 16: 18,228,390 M103K probably damaging Het
Zfp595 C T 13: 67,317,305 G298E probably damaging Het
Zfp738 T G 13: 67,670,021 H617P possibly damaging Het
Zfp9 A T 6: 118,465,202 H166Q probably damaging Het
Zp3r C A 1: 130,618,334 D80Y probably damaging Het
Other mutations in Arfgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arfgef1 APN 1 10199787 missense probably benign
IGL00919:Arfgef1 APN 1 10173237 missense probably damaging 1.00
IGL01022:Arfgef1 APN 1 10174076 missense probably damaging 1.00
IGL01155:Arfgef1 APN 1 10198982 splice site probably benign
IGL01288:Arfgef1 APN 1 10213211 missense possibly damaging 0.67
IGL01397:Arfgef1 APN 1 10159571 missense probably benign 0.40
IGL01433:Arfgef1 APN 1 10153432 missense probably damaging 1.00
IGL01653:Arfgef1 APN 1 10159908 nonsense probably null
IGL01669:Arfgef1 APN 1 10159615 missense probably damaging 1.00
IGL01795:Arfgef1 APN 1 10147528 missense probably benign 0.01
IGL01860:Arfgef1 APN 1 10154396 missense probably damaging 1.00
IGL02137:Arfgef1 APN 1 10213113 missense probably damaging 1.00
IGL02365:Arfgef1 APN 1 10199883 missense probably benign 0.00
IGL02519:Arfgef1 APN 1 10209668 missense probably benign 0.13
IGL02542:Arfgef1 APN 1 10172842 missense probably benign 0.24
IGL02604:Arfgef1 APN 1 10181050 splice site probably benign
IGL02743:Arfgef1 APN 1 10199829 missense probably benign 0.00
IGL03225:Arfgef1 APN 1 10154318 missense probably damaging 1.00
Collected UTSW 1 10180938 missense probably damaging 1.00
uncle_joe UTSW 1 10160835 missense probably damaging 1.00
I2288:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
I2289:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
R0383:Arfgef1 UTSW 1 10198842 critical splice donor site probably null
R0636:Arfgef1 UTSW 1 10199851 missense probably benign
R1006:Arfgef1 UTSW 1 10140481 missense probably benign 0.00
R1212:Arfgef1 UTSW 1 10216559 missense probably benign 0.05
R1233:Arfgef1 UTSW 1 10184090 missense probably damaging 1.00
R1346:Arfgef1 UTSW 1 10159733 missense probably benign 0.41
R1416:Arfgef1 UTSW 1 10172939 missense probably damaging 1.00
R1477:Arfgef1 UTSW 1 10189284 missense probably damaging 1.00
R1581:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1587:Arfgef1 UTSW 1 10159959 missense probably damaging 0.99
R1602:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1745:Arfgef1 UTSW 1 10173255 missense probably damaging 1.00
R1831:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1832:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1833:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1918:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1919:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2059:Arfgef1 UTSW 1 10188752 splice site probably null
R2146:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2148:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2149:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2150:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2373:Arfgef1 UTSW 1 10174142 missense probably damaging 1.00
R2516:Arfgef1 UTSW 1 10153654 missense possibly damaging 0.89
R3863:Arfgef1 UTSW 1 10142586 frame shift probably null
R3916:Arfgef1 UTSW 1 10189443 missense probably benign 0.01
R3948:Arfgef1 UTSW 1 10142586 frame shift probably null
R3949:Arfgef1 UTSW 1 10142586 frame shift probably null
R3977:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3978:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3979:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R4086:Arfgef1 UTSW 1 10163759 missense probably benign 0.06
R4175:Arfgef1 UTSW 1 10159636 missense probably damaging 1.00
R4257:Arfgef1 UTSW 1 10159546 intron probably benign
R4572:Arfgef1 UTSW 1 10213141 missense probably damaging 1.00
R4652:Arfgef1 UTSW 1 10173262 missense probably damaging 0.98
R4678:Arfgef1 UTSW 1 10142666 missense probably benign 0.03
R4737:Arfgef1 UTSW 1 10189611 missense possibly damaging 0.85
R4779:Arfgef1 UTSW 1 10153733 missense probably damaging 1.00
R4818:Arfgef1 UTSW 1 10216547 missense probably benign
R4898:Arfgef1 UTSW 1 10159573 missense possibly damaging 0.75
R4979:Arfgef1 UTSW 1 10213109 missense probably damaging 1.00
R5039:Arfgef1 UTSW 1 10199736 missense probably benign 0.37
R5194:Arfgef1 UTSW 1 10204907 missense probably benign 0.09
R5428:Arfgef1 UTSW 1 10160835 missense probably damaging 1.00
R5533:Arfgef1 UTSW 1 10199727 critical splice donor site probably null
R5547:Arfgef1 UTSW 1 10160976 missense probably damaging 1.00
R5562:Arfgef1 UTSW 1 10144746 missense probably damaging 1.00
R5635:Arfgef1 UTSW 1 10188860 missense possibly damaging 0.81
R5697:Arfgef1 UTSW 1 10160838 missense probably benign 0.03
R5704:Arfgef1 UTSW 1 10159583 missense probably damaging 0.98
R5722:Arfgef1 UTSW 1 10138884 missense probably benign 0.04
R5793:Arfgef1 UTSW 1 10209528 missense probably benign 0.01
R5835:Arfgef1 UTSW 1 10160739 missense probably damaging 1.00
R5870:Arfgef1 UTSW 1 10180938 missense probably damaging 1.00
R5990:Arfgef1 UTSW 1 10172921 missense probably damaging 0.99
R6290:Arfgef1 UTSW 1 10188811 missense possibly damaging 0.91
R6460:Arfgef1 UTSW 1 10213060 missense probably damaging 1.00
R6613:Arfgef1 UTSW 1 10194396 missense possibly damaging 0.95
R6802:Arfgef1 UTSW 1 10189452 missense probably benign 0.35
R6967:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6967:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6968:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6968:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6969:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6969:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6970:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6970:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R7092:Arfgef1 UTSW 1 10153676 missense probably damaging 1.00
R7251:Arfgef1 UTSW 1 10198975 missense possibly damaging 0.81
R7334:Arfgef1 UTSW 1 10184460 missense probably damaging 1.00
R7399:Arfgef1 UTSW 1 10180897 missense probably benign 0.00
R7631:Arfgef1 UTSW 1 10232469 missense probably benign 0.00
R7699:Arfgef1 UTSW 1 10194411 missense possibly damaging 0.78
R7700:Arfgef1 UTSW 1 10194411 missense possibly damaging 0.78
R7772:Arfgef1 UTSW 1 10157010 missense possibly damaging 0.96
V1662:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAACCTTAAACATCGGCCTCACG -3'
(R):5'- GCTTTCCACTTAAGCAAGTGTTGTCTG -3'

Sequencing Primer
(F):5'- CGTGCTCCAAGTGTGTTGC -3'
(R):5'- GCTATCTCGATATAAAGACCACTGTC -3'
Posted On2013-05-23