Mutagenetix > Incidental Mutations

Incidental Mutation 'R5287:Csmd2'

424398

Institutional Source

Beutler Lab

Gene Symbol

Csmd2

Ensembl Gene

ENSMUSG00000028804

Gene Name

CUB and Sushi multiple domains 2

Synonyms

MMRRC Submission

042871-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.151) question?

Stock #

R5287 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127987857-128567656 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 128486884 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 2078 (R2078C)

Ref Sequence

ENSEMBL: ENSMUSP00000138958 (fasta)

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148247

Predicted Effect

probably benign
Transcript: ENSMUST00000184063
AA Change: R2078C

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

Meta Mutation Damage Score

0.1768

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (56/57)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	G	T	17: 56,876,221		probably benign	Het
Accs	T	C	2: 93,835,953	D463G	probably damaging	Het
Adcy8	C	T	15: 64,716,152	V929I	probably benign	Het
Anp32a	A	T	9: 62,341,993	I16F	possibly damaging	Het
Arpin	T	C	7: 79,928,249	E144G	probably damaging	Het
Asb18	T	C	1: 90,014,388	T64A	probably benign	Het
Asxl2	A	G	12: 3,496,893	N559S	probably benign	Het
Brd7	G	T	8: 88,357,541	Q148K	probably damaging	Het
Brinp1	A	G	4: 68,792,964	W336R	probably benign	Het
Btnl9	A	G	11: 49,169,607	V438A	probably benign	Het
Cat	T	C	2: 103,474,360	T107A	probably damaging	Het
Catsperg2	T	C	7: 29,697,838	Y1080C	possibly damaging	Het
Ccdc138	T	A	10: 58,575,705	F632I	possibly damaging	Het
Cd46	C	T	1: 195,062,411	V340I	possibly damaging	Het
Celf1	T	C	2: 91,009,207	S326P	possibly damaging	Het
Ces1e	T	G	8: 93,208,612	D404A	probably benign	Het
Chd3	A	T	11: 69,349,069		probably null	Het
Clhc1	A	G	11: 29,578,244		probably benign	Het
Cops8	C	T	1: 90,606,620		probably benign	Het
Cpox	G	A	16: 58,675,286	G322D	probably damaging	Het
Dnm1l	A	C	16: 16,333,868	V240G	probably damaging	Het
Fam109a	A	G	5: 121,852,731	E52G	possibly damaging	Het
Fam196b	A	T	11: 34,403,058	T367S	probably benign	Het
Fam208b	G	A	13: 3,575,744	S1402L	probably benign	Het
Fezf1	C	T	6: 23,248,011	V22M	probably benign	Het
Gm6818	T	G	7: 38,400,487		noncoding transcript	Het
Hand2	C	T	8: 57,322,045	L47F	probably damaging	Het
Itga7	C	A	10: 128,943,158	R351S	probably benign	Het
Mmp8	G	T	9: 7,567,506	A456S	probably benign	Het
Mroh5	TGGAG	TG	15: 73,783,074		probably benign	Het
Olfr1416	A	T	1: 92,480,297	V108E	possibly damaging	Het
Opn4	T	C	14: 34,592,937	T460A	probably benign	Het
Otog	T	C	7: 46,269,329	F943S	probably damaging	Het
Pcnx	A	T	12: 81,982,051	Y1668F	probably damaging	Het
Phf24	A	T	4: 42,933,831		probably null	Het
Phkg2	GCTGCCGGACGAGTGGCCT	GCT	7: 127,582,757		probably null	Het
Ppargc1a	G	A	5: 51,462,825		probably benign	Het
Ptprd	G	A	4: 75,954,168	R1355*	probably null	Het
Ptprn2	A	T	12: 117,211,862	M721L	probably damaging	Het
Sec23ip	A	G	7: 128,766,136	E624G	probably benign	Het
Sfmbt1	G	A	14: 30,816,820	V799M	probably damaging	Het
Snrnp200	T	C	2: 127,231,687	V1335A	probably benign	Het
Sp140	G	A	1: 85,610,824		probably null	Het
Spdye4c	T	C	2: 128,592,640	S46P	possibly damaging	Het
Syde1	T	C	10: 78,590,037	R99G	probably benign	Het
T2	A	T	17: 8,418,003	M57L	probably benign	Het
Tfap2e	T	C	4: 126,734,646	I172M	probably benign	Het
Tk1	A	T	11: 117,816,541	V140E	probably damaging	Het
Tln2	G	A	9: 67,242,359	T1192M	probably damaging	Het
Tmed8	C	A	12: 87,174,183	A210S	probably damaging	Het
Tnip2	A	G	5: 34,513,764	L45P	probably damaging	Het
Ttc3	T	C	16: 94,459,844	V1396A	probably benign	Het
Ttn	G	T	2: 76,732,092	S28803Y	probably damaging	Het
Wdr90	A	T	17: 25,861,467		probably benign	Het
Zfp7	G	A	15: 76,891,222	R488Q	probably damaging	Het

Other mutations in Csmd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Csmd2	APN	4	128483473	missense	probably benign	0.03
IGL01098:Csmd2	APN	4	128059052	missense	probably damaging	0.99
IGL01114:Csmd2	APN	4	128369130	missense	probably benign	0.04
IGL01364:Csmd2	APN	4	128414288	missense	probably benign	0.01
IGL01530:Csmd2	APN	4	128414301	missense	possibly damaging	0.66
IGL01582:Csmd2	APN	4	128563305	nonsense	probably null
IGL01670:Csmd2	APN	4	128513371	splice site	probably benign
IGL01707:Csmd2	APN	4	128383005	missense	possibly damaging	0.81
IGL01810:Csmd2	APN	4	128480845	splice site	probably benign
IGL01837:Csmd2	APN	4	128419570	missense	possibly damaging	0.92
IGL01924:Csmd2	APN	4	128559947	missense	unknown
IGL02013:Csmd2	APN	4	128321323	missense	possibly damaging	0.47
IGL02020:Csmd2	APN	4	128559879	missense	probably damaging	1.00
IGL02037:Csmd2	APN	4	128477470	splice site	probably benign
IGL02303:Csmd2	APN	4	128369008	missense	probably benign	0.01
IGL02317:Csmd2	APN	4	128463727	splice site	probably benign
IGL02322:Csmd2	APN	4	128463727	splice site	probably benign
IGL02338:Csmd2	APN	4	128395066	missense	possibly damaging	0.79
IGL02412:Csmd2	APN	4	128513372	splice site	probably benign
IGL02428:Csmd2	APN	4	128474816	missense	possibly damaging	0.82
IGL02491:Csmd2	APN	4	128534257	missense	probably benign
IGL02701:Csmd2	APN	4	128496141	missense	probably benign	0.17
IGL02801:Csmd2	APN	4	128552075	splice site	probably null
IGL02818:Csmd2	APN	4	128209728	missense	probably damaging	1.00
IGL02863:Csmd2	APN	4	128521884	missense	probably benign	0.00
IGL02876:Csmd2	APN	4	128321335	nonsense	probably null
IGL02977:Csmd2	APN	4	128493276	nonsense	probably null
IGL03006:Csmd2	APN	4	128480765	splice site	probably benign
IGL03032:Csmd2	APN	4	128519041	missense	probably benign	0.03
IGL03148:Csmd2	APN	4	128384269	missense	probably damaging	1.00
IGL03157:Csmd2	APN	4	128414299	nonsense	probably null
IGL03245:Csmd2	APN	4	128509122	missense	probably benign	0.12
IGL03376:Csmd2	APN	4	128517671	missense	probably benign	0.03
IGL03014:Csmd2	UTSW	4	128296429	missense	probably benign	0.01
R0109:Csmd2	UTSW	4	128544743	missense	probably benign	0.03
R0112:Csmd2	UTSW	4	128496029	missense	probably damaging	1.00
R0157:Csmd2	UTSW	4	128521911	missense	probably benign	0.02
R0390:Csmd2	UTSW	4	128133673	intron	probably benign
R0441:Csmd2	UTSW	4	128520230	missense	probably benign	0.00
R0519:Csmd2	UTSW	4	128487005	missense	possibly damaging	0.95
R0743:Csmd2	UTSW	4	128113676	missense	probably benign	0.00
R0746:Csmd2	UTSW	4	128414297	missense	probably damaging	1.00
R0973:Csmd2	UTSW	4	128496188	missense	possibly damaging	0.91
R1019:Csmd2	UTSW	4	128522014	missense	probably benign	0.00
R1476:Csmd2	UTSW	4	128487001	missense	probably benign	0.08
R1641:Csmd2	UTSW	4	128483395	missense	possibly damaging	0.68
R1709:Csmd2	UTSW	4	128496195	missense	probably damaging	0.96
R2866:Csmd2	UTSW	4	128414392	critical splice donor site	probably null
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2873:Csmd2	UTSW	4	128557718	missense	unknown
R2893:Csmd2	UTSW	4	128538993	splice site	probably null
R3796:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3797:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3798:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3914:Csmd2	UTSW	4	128321324	missense	probably benign	0.07
R4198:Csmd2	UTSW	4	128510924	missense	probably benign	0.07
R4489:Csmd2	UTSW	4	128381945	missense	possibly damaging	0.68
R4571:Csmd2	UTSW	4	128480095	splice site	probably null
R4581:Csmd2	UTSW	4	128369088	missense	probably benign	0.02
R4599:Csmd2	UTSW	4	127988128	missense	probably benign	0.35
R4649:Csmd2	UTSW	4	128546073	missense	probably benign
R4706:Csmd2	UTSW	4	128544751	missense	probably benign
R4776:Csmd2	UTSW	4	128442892	missense	probably benign	0.09
R4838:Csmd2	UTSW	4	128517749	missense	probably benign
R4900:Csmd2	UTSW	4	128452525	missense	probably benign	0.03
R4999:Csmd2	UTSW	4	128521930	missense	probably benign	0.00
R5024:Csmd2	UTSW	4	128321348	missense	possibly damaging	0.94
R5034:Csmd2	UTSW	4	128059108	missense	probably damaging	0.98
R5152:Csmd2	UTSW	4	128552035	missense	probably benign	0.27
R5172:Csmd2	UTSW	4	128477397	missense	probably benign	0.10
R5231:Csmd2	UTSW	4	128546049	missense	probably benign	0.00
R5279:Csmd2	UTSW	4	128456914	missense	probably benign	0.30
R5403:Csmd2	UTSW	4	128486884	missense	probably benign	0.01
R5410:Csmd2	UTSW	4	128548819	missense	probably benign
R5551:Csmd2	UTSW	4	128510948	missense	possibly damaging	0.83
R5566:Csmd2	UTSW	4	128462889	critical splice donor site	probably null
R5826:Csmd2	UTSW	4	128519199	splice site	probably null
R5907:Csmd2	UTSW	4	128197385	missense	probably damaging	0.99
R5913:Csmd2	UTSW	4	128551988	missense	probably benign	0.01
R5970:Csmd2	UTSW	4	128546151	missense	probably benign	0.00
R5977:Csmd2	UTSW	4	128059034	missense	probably damaging	1.00
R6027:Csmd2	UTSW	4	128559946	missense	unknown
R6075:Csmd2	UTSW	4	128486865	missense	probably benign	0.15
R6129:Csmd2	UTSW	4	128493334	missense	possibly damaging	0.79
R6363:Csmd2	UTSW	4	128400379	missense	probably benign	0.00
R6366:Csmd2	UTSW	4	128483452	missense	probably benign	0.00
R6404:Csmd2	UTSW	4	128521950	missense	possibly damaging	0.90
R6437:Csmd2	UTSW	4	127988100	missense	probably benign	0.24
R6441:Csmd2	UTSW	4	128394964	missense	probably benign	0.03
R6643:Csmd2	UTSW	4	128372597	missense	probably benign	0.14
R6724:Csmd2	UTSW	4	128563371	missense	probably damaging	0.97
R6734:Csmd2	UTSW	4	128463813	missense	probably benign	0.00
R6750:Csmd2	UTSW	4	128197225	missense	possibly damaging	0.91
R6801:Csmd2	UTSW	4	128383950	missense	probably benign	0.11
R6842:Csmd2	UTSW	4	128509159	missense	possibly damaging	0.72
R6843:Csmd2	UTSW	4	128463794	missense	probably benign	0.27
R6868:Csmd2	UTSW	4	128442840	missense	probably benign
R6882:Csmd2	UTSW	4	128449269	missense	probably benign	0.01
R7019:Csmd2	UTSW	4	128369063	missense
R7028:Csmd2	UTSW	4	128277228	missense
R7096:Csmd2	UTSW	4	128462726	missense
R7122:Csmd2	UTSW	4	128449227	missense
R7125:Csmd2	UTSW	4	128496162	missense
R7197:Csmd2	UTSW	4	128511033	missense
R7234:Csmd2	UTSW	4	128456779	missense
R7299:Csmd2	UTSW	4	128528262	missense
R7301:Csmd2	UTSW	4	128528262	missense
R7319:Csmd2	UTSW	4	128393679	missense
R7331:Csmd2	UTSW	4	128564228	splice site	probably null
R7332:Csmd2	UTSW	4	128419567	missense
R7352:Csmd2	UTSW	4	128557636	missense
R7402:Csmd2	UTSW	4	128322095	missense
R7402:Csmd2	UTSW	4	128322096	missense
R7474:Csmd2	UTSW	4	128546127	missense
R7555:Csmd2	UTSW	4	128452458	missense
R7592:Csmd2	UTSW	4	128463798	missense
R7700:Csmd2	UTSW	4	128545756	splice site	probably null
R7714:Csmd2	UTSW	4	128382950	nonsense	probably null
R7734:Csmd2	UTSW	4	128552057	missense
R7735:Csmd2	UTSW	4	128456930	critical splice donor site	probably null
R7757:Csmd2	UTSW	4	128483456	missense
R7805:Csmd2	UTSW	4	128419573	missense
R7823:Csmd2	UTSW	4	128209905	missense
R7904:Csmd2	UTSW	4	128419553	missense
R7946:Csmd2	UTSW	4	128520265	missense
R7964:Csmd2	UTSW	4	128523510	missense
R7968:Csmd2	UTSW	4	128197325	missense
R8003:Csmd2	UTSW	4	128539187	nonsense	probably null
R8071:Csmd2	UTSW	4	128393538	missense
R8504:Csmd2	UTSW	4	128546690	missense
R8511:Csmd2	UTSW	4	128368899	missense
R8517:Csmd2	UTSW	4	128552686	missense
R8704:Csmd2	UTSW	4	128197354	missense
R8722:Csmd2	UTSW	4	128551950	unclassified	probably benign
R8729:Csmd2	UTSW	4	128462845	missense
R8801:Csmd2	UTSW	4	128563402	missense	probably damaging	0.97
R8803:Csmd2	UTSW	4	128546684	missense
R8839:Csmd2	UTSW	4	128442888	missense
R8867:Csmd2	UTSW	4	128557676	missense
R8913:Csmd2	UTSW	4	128523558	missense
R8928:Csmd2	UTSW	4	128475789	missense
R8974:Csmd2	UTSW	4	128552587	missense
R9001:Csmd2	UTSW	4	128414286	missense
R9132:Csmd2	UTSW	4	128549214	missense
R9245:Csmd2	UTSW	4	128306375	missense
R9249:Csmd2	UTSW	4	128419530	nonsense	probably null
R9254:Csmd2	UTSW	4	128197319	missense
R9265:Csmd2	UTSW	4	128400370	missense
R9407:Csmd2	UTSW	4	128548820	missense
R9432:Csmd2	UTSW	4	128277211	missense
Z1177:Csmd2	UTSW	4	128530797	missense

Predicted Primers

PCR Primer
(F):5'- ATTCTGGACCCTGGAAGAGTC -3'
(R):5'- AGACCTGTTGCCCCTTAGTC -3'

Sequencing Primer
(F):5'- ACCCTGGAAGAGTCACCGTG -3'
(R):5'- CCTCTTTGCATGCATAAGACGAGG -3'

Posted On

2016-08-04