Incidental Mutation 'R5287:Syde1'
ID424416
Institutional Source Beutler Lab
Gene Symbol Syde1
Ensembl Gene ENSMUSG00000032714
Gene Namesynapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Synonyms1200008N06Rik, mSYD1A
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5287 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78584503-78591964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78590037 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 99 (R99G)
Ref Sequence ENSEMBL: ENSMUSP00000043085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040580]
Predicted Effect probably benign
Transcript: ENSMUST00000040580
AA Change: R99G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043085
Gene: ENSMUSG00000032714
AA Change: R99G

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 56 69 N/A INTRINSIC
low complexity region 114 127 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
RhoGAP 411 601 1.49e-56 SMART
low complexity region 638 652 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218641
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Rho GTPase-activating protein highly expressed in placenta. The encoded protein is involved in cytoskeletal remodeling and trophoblast cell migration. Decreased expression of this gene has been associated with intrauterine growth restriction (IUGR). [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced miniature excitatory postsynaptic current freuqency and docked vesciles in CA1 synpases. Mice homozygous for another allele exhibit reduced embryos and placental weight with abnormal placenta morphology and placental vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Btnl9 A G 11: 49,169,607 V438A probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Celf1 T C 2: 91,009,207 S326P possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Clhc1 A G 11: 29,578,244 probably benign Het
Cops8 C T 1: 90,606,620 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Hand2 C T 8: 57,322,045 L47F probably damaging Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mmp8 G T 9: 7,567,506 A456S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Ptprn2 A T 12: 117,211,862 M721L probably damaging Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Spdye4c T C 2: 128,592,640 S46P possibly damaging Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tk1 A T 11: 117,816,541 V140E probably damaging Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Syde1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Syde1 APN 10 78585809 missense probably damaging 1.00
IGL01285:Syde1 APN 10 78588887 missense probably damaging 1.00
IGL01529:Syde1 APN 10 78590181 missense probably benign
IGL01869:Syde1 APN 10 78588919 missense possibly damaging 0.93
IGL02098:Syde1 APN 10 78589371 missense probably damaging 1.00
IGL03187:Syde1 APN 10 78589109 missense possibly damaging 0.79
R0014:Syde1 UTSW 10 78590034 missense probably benign
R0561:Syde1 UTSW 10 78589376 missense probably damaging 1.00
R0605:Syde1 UTSW 10 78589095 unclassified probably benign
R1713:Syde1 UTSW 10 78585696 missense probably damaging 1.00
R1756:Syde1 UTSW 10 78586980 missense probably benign
R4491:Syde1 UTSW 10 78590228 missense probably benign 0.00
R4846:Syde1 UTSW 10 78588897 missense probably damaging 0.99
R5092:Syde1 UTSW 10 78589418 missense probably benign
R5611:Syde1 UTSW 10 78585891 missense probably benign
R5951:Syde1 UTSW 10 78589316 missense possibly damaging 0.87
R5957:Syde1 UTSW 10 78590117 missense probably damaging 1.00
R6169:Syde1 UTSW 10 78586104 missense probably damaging 1.00
R7083:Syde1 UTSW 10 78587069 missense probably benign 0.44
R7150:Syde1 UTSW 10 78586198 nonsense probably null
R7239:Syde1 UTSW 10 78588781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTTATGGTCCTTGCGGG -3'
(R):5'- AGAACCTCGTGTCCTTGAAG -3'

Sequencing Primer
(F):5'- AACACCTGGAGTATAGGGTTTG -3'
(R):5'- TCCTTGAAGGGTCTCAGGC -3'
Posted On2016-08-04