Incidental Mutation 'R5287:Clhc1'
ID424418
Institutional Source Beutler Lab
Gene Symbol Clhc1
Ensembl Gene ENSMUSG00000020461
Gene Nameclathrin heavy chain linker domain containing 1
Synonyms1700034F02Rik
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5287 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29547950-29578367 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 29578244 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020753] [ENSMUST00000208530]
Predicted Effect probably benign
Transcript: ENSMUST00000020753
SMART Domains Protein: ENSMUSP00000020753
Gene: ENSMUSG00000020461

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 28 152 2.6e-26 PFAM
Pfam:Clathrin_H_link 302 365 3.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131366
Predicted Effect probably benign
Transcript: ENSMUST00000208530
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Btnl9 A G 11: 49,169,607 V438A probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Celf1 T C 2: 91,009,207 S326P possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Cops8 C T 1: 90,606,620 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Hand2 C T 8: 57,322,045 L47F probably damaging Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mmp8 G T 9: 7,567,506 A456S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Ptprn2 A T 12: 117,211,862 M721L probably damaging Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Spdye4c T C 2: 128,592,640 S46P possibly damaging Het
Syde1 T C 10: 78,590,037 R99G probably benign Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tk1 A T 11: 117,816,541 V140E probably damaging Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Clhc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Clhc1 APN 11 29571745 missense probably damaging 0.99
IGL00976:Clhc1 APN 11 29561389 missense probably benign 0.43
IGL01826:Clhc1 APN 11 29553765 splice site probably null
IGL02029:Clhc1 APN 11 29560798 missense probably benign 0.01
IGL02479:Clhc1 APN 11 29578107 missense probably damaging 0.98
R0553:Clhc1 UTSW 11 29561366 splice site probably benign
R1313:Clhc1 UTSW 11 29571678 missense probably benign
R1313:Clhc1 UTSW 11 29571678 missense probably benign
R1482:Clhc1 UTSW 11 29553725 missense probably damaging 1.00
R1624:Clhc1 UTSW 11 29569287 missense possibly damaging 0.85
R1742:Clhc1 UTSW 11 29557647 splice site probably null
R2094:Clhc1 UTSW 11 29557771 missense probably benign 0.13
R2130:Clhc1 UTSW 11 29557663 missense probably benign 0.33
R2237:Clhc1 UTSW 11 29569329 missense probably benign 0.30
R3814:Clhc1 UTSW 11 29571826 missense possibly damaging 0.57
R3854:Clhc1 UTSW 11 29571789 missense probably damaging 1.00
R4417:Clhc1 UTSW 11 29571826 missense possibly damaging 0.57
R4659:Clhc1 UTSW 11 29578229 makesense probably null
R5021:Clhc1 UTSW 11 29560627 missense probably benign 0.01
R5246:Clhc1 UTSW 11 29575434 missense probably damaging 1.00
R5657:Clhc1 UTSW 11 29561431 missense probably benign 0.03
R5771:Clhc1 UTSW 11 29563854 missense possibly damaging 0.94
R6050:Clhc1 UTSW 11 29561397 missense possibly damaging 0.76
R6211:Clhc1 UTSW 11 29578145 missense probably damaging 1.00
R6500:Clhc1 UTSW 11 29560542 missense possibly damaging 0.87
R6615:Clhc1 UTSW 11 29578149 missense possibly damaging 0.75
R6944:Clhc1 UTSW 11 29569346 missense probably damaging 0.97
R7252:Clhc1 UTSW 11 29563937 missense probably benign 0.01
X0023:Clhc1 UTSW 11 29569305 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGGCCTGGTTTGAGAGTAAC -3'
(R):5'- CCACATGATAGAGTGAAGCAATGTTTC -3'

Sequencing Primer
(F):5'- CCAGATGTGATTGAGCATCTTG -3'
(R):5'- GCAATGTTTCAGTGTTTCAAGAGC -3'
Posted On2016-08-04