Incidental Mutation 'R5287:Chd3'
ID 424421
Institutional Source Beutler Lab
Gene Symbol Chd3
Ensembl Gene ENSMUSG00000018474
Gene Name chromodomain helicase DNA binding protein 3
Synonyms 2600010P09Rik, Mi-2 alpha, Chd7, Prp7, Prp9-1
MMRRC Submission 042871-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5287 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 69234099-69260232 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 69239895 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661]
AlphaFold B1AR17
Predicted Effect probably null
Transcript: ENSMUST00000092971
SMART Domains Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 199 253 1.4e-34 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1754 1926 8.6e-104 PFAM
low complexity region 1935 1967 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108661
SMART Domains Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 200 253 4.3e-29 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1789 1960 4.9e-93 PFAM
low complexity region 1969 2001 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122992
Predicted Effect probably null
Transcript: ENSMUST00000128981
SMART Domains Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 55 87 N/A INTRINSIC
Pfam:CHDNT 107 160 3.9e-29 PFAM
low complexity region 164 190 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
low complexity region 305 321 N/A INTRINSIC
PHD 341 384 1.54e-14 SMART
RING 342 383 4.25e-1 SMART
PHD 417 460 1.74e-13 SMART
RING 418 459 3.93e0 SMART
CHROMO 465 544 7.23e-14 SMART
CHROMO 588 637 2.85e-12 SMART
low complexity region 656 662 N/A INTRINSIC
DEXDc 691 903 1.64e-31 SMART
low complexity region 1014 1032 N/A INTRINSIC
HELICc 1049 1133 2.61e-25 SMART
low complexity region 1197 1210 N/A INTRINSIC
DUF1087 1252 1316 2.98e-33 SMART
DUF1086 1322 1478 1.79e-109 SMART
low complexity region 1480 1509 N/A INTRINSIC
low complexity region 1579 1592 N/A INTRINSIC
Pfam:CHDCT2 1662 1833 4.4e-93 PFAM
low complexity region 1842 1874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157256
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T C 2: 93,666,298 (GRCm39) D463G probably damaging Het
Acsbg3 G T 17: 57,183,221 (GRCm39) probably benign Het
Adcy8 C T 15: 64,588,001 (GRCm39) V929I probably benign Het
Anp32a A T 9: 62,249,275 (GRCm39) I16F possibly damaging Het
Arpin T C 7: 79,577,997 (GRCm39) E144G probably damaging Het
Asb18 T C 1: 89,942,110 (GRCm39) T64A probably benign Het
Asxl2 A G 12: 3,546,893 (GRCm39) N559S probably benign Het
Brd7 G T 8: 89,084,169 (GRCm39) Q148K probably damaging Het
Brinp1 A G 4: 68,711,201 (GRCm39) W336R probably benign Het
Btnl9 A G 11: 49,060,434 (GRCm39) V438A probably benign Het
Cat T C 2: 103,304,705 (GRCm39) T107A probably damaging Het
Catsperg2 T C 7: 29,397,263 (GRCm39) Y1080C possibly damaging Het
Ccdc138 T A 10: 58,411,527 (GRCm39) F632I possibly damaging Het
Cd46 C T 1: 194,744,719 (GRCm39) V340I possibly damaging Het
Celf1 T C 2: 90,839,552 (GRCm39) S326P possibly damaging Het
Ces1e T G 8: 93,935,240 (GRCm39) D404A probably benign Het
Clhc1 A G 11: 29,528,244 (GRCm39) probably benign Het
Cops8 C T 1: 90,534,342 (GRCm39) probably benign Het
Cpox G A 16: 58,495,649 (GRCm39) G322D probably damaging Het
Csmd2 C T 4: 128,380,677 (GRCm39) R2078C probably benign Het
Dnm1l A C 16: 16,151,732 (GRCm39) V240G probably damaging Het
Fezf1 C T 6: 23,248,010 (GRCm39) V22M probably benign Het
Gm6818 T G 7: 38,099,911 (GRCm39) noncoding transcript Het
Hand2 C T 8: 57,775,080 (GRCm39) L47F probably damaging Het
Insyn2b A T 11: 34,353,058 (GRCm39) T367S probably benign Het
Itga7 C A 10: 128,779,027 (GRCm39) R351S probably benign Het
Mmp8 G T 9: 7,567,507 (GRCm39) A456S probably benign Het
Mroh5 TGGAG TG 15: 73,654,923 (GRCm39) probably benign Het
Opn4 T C 14: 34,314,894 (GRCm39) T460A probably benign Het
Or6b2 A T 1: 92,408,019 (GRCm39) V108E possibly damaging Het
Otog T C 7: 45,918,753 (GRCm39) F943S probably damaging Het
Pcnx1 A T 12: 82,028,825 (GRCm39) Y1668F probably damaging Het
Pheta1 A G 5: 121,990,794 (GRCm39) E52G possibly damaging Het
Phf24 A T 4: 42,933,831 (GRCm39) probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,181,929 (GRCm39) probably null Het
Ppargc1a G A 5: 51,620,167 (GRCm39) probably benign Het
Ptprd G A 4: 75,872,405 (GRCm39) R1355* probably null Het
Ptprn2 A T 12: 117,175,482 (GRCm39) M721L probably damaging Het
Sec23ip A G 7: 128,367,860 (GRCm39) E624G probably benign Het
Sfmbt1 G A 14: 30,538,777 (GRCm39) V799M probably damaging Het
Snrnp200 T C 2: 127,073,607 (GRCm39) V1335A probably benign Het
Sp140 G A 1: 85,538,545 (GRCm39) probably null Het
Spdye4c T C 2: 128,434,560 (GRCm39) S46P possibly damaging Het
Syde1 T C 10: 78,425,871 (GRCm39) R99G probably benign Het
T2 A T 17: 8,636,835 (GRCm39) M57L probably benign Het
Tasor2 G A 13: 3,625,744 (GRCm39) S1402L probably benign Het
Tfap2e T C 4: 126,628,439 (GRCm39) I172M probably benign Het
Tk1 A T 11: 117,707,367 (GRCm39) V140E probably damaging Het
Tln2 G A 9: 67,149,641 (GRCm39) T1192M probably damaging Het
Tmed8 C A 12: 87,220,957 (GRCm39) A210S probably damaging Het
Tnip2 A G 5: 34,671,108 (GRCm39) L45P probably damaging Het
Ttc3 T C 16: 94,260,703 (GRCm39) V1396A probably benign Het
Ttn G T 2: 76,562,436 (GRCm39) S28803Y probably damaging Het
Wdr90 A T 17: 26,080,441 (GRCm39) probably benign Het
Zfp7 G A 15: 76,775,422 (GRCm39) R488Q probably damaging Het
Other mutations in Chd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Chd3 APN 11 69,247,888 (GRCm39) missense probably damaging 0.96
IGL00551:Chd3 APN 11 69,237,455 (GRCm39) missense probably damaging 1.00
IGL00661:Chd3 APN 11 69,248,209 (GRCm39) missense possibly damaging 0.84
IGL00698:Chd3 APN 11 69,240,697 (GRCm39) missense probably damaging 0.98
IGL01075:Chd3 APN 11 69,250,791 (GRCm39) missense probably damaging 1.00
IGL01309:Chd3 APN 11 69,248,557 (GRCm39) missense probably damaging 0.99
IGL01317:Chd3 APN 11 69,244,037 (GRCm39) missense probably damaging 1.00
IGL01374:Chd3 APN 11 69,250,806 (GRCm39) missense probably damaging 0.99
IGL01444:Chd3 APN 11 69,239,568 (GRCm39) missense probably benign 0.28
IGL01617:Chd3 APN 11 69,249,060 (GRCm39) unclassified probably benign
IGL01635:Chd3 APN 11 69,252,076 (GRCm39) splice site probably benign
IGL01942:Chd3 APN 11 69,240,931 (GRCm39) critical splice donor site probably null
IGL01962:Chd3 APN 11 69,248,319 (GRCm39) missense possibly damaging 0.46
IGL01981:Chd3 APN 11 69,251,501 (GRCm39) missense probably damaging 0.99
IGL02022:Chd3 APN 11 69,251,886 (GRCm39) missense probably damaging 1.00
IGL02098:Chd3 APN 11 69,250,655 (GRCm39) missense probably damaging 1.00
IGL02218:Chd3 APN 11 69,242,920 (GRCm39) unclassified probably benign
IGL02415:Chd3 APN 11 69,239,739 (GRCm39) splice site probably benign
IGL02648:Chd3 APN 11 69,242,976 (GRCm39) missense probably damaging 1.00
IGL02951:Chd3 APN 11 69,251,874 (GRCm39) critical splice donor site probably null
IGL03030:Chd3 APN 11 69,245,230 (GRCm39) missense possibly damaging 0.64
IGL03102:Chd3 APN 11 69,252,022 (GRCm39) nonsense probably null
IGL03168:Chd3 APN 11 69,239,741 (GRCm39) splice site probably benign
IGL03327:Chd3 APN 11 69,241,012 (GRCm39) missense probably damaging 1.00
burg UTSW 11 69,247,380 (GRCm39) missense probably damaging 1.00
castello UTSW 11 69,246,648 (GRCm39) critical splice acceptor site probably benign
feste UTSW 11 69,245,252 (GRCm39) nonsense probably null
Fortress UTSW 11 69,254,876 (GRCm39) nonsense probably null
moat UTSW 11 69,250,011 (GRCm39) missense probably damaging 0.98
Redoubt UTSW 11 69,244,727 (GRCm39) unclassified probably benign
schloss UTSW 11 69,252,886 (GRCm39) nonsense probably null
siege UTSW 11 69,247,844 (GRCm39) missense probably damaging 1.00
R0009:Chd3 UTSW 11 69,240,732 (GRCm39) missense probably damaging 0.99
R0009:Chd3 UTSW 11 69,240,732 (GRCm39) missense probably damaging 0.99
R0056:Chd3 UTSW 11 69,250,739 (GRCm39) unclassified probably benign
R0129:Chd3 UTSW 11 69,239,327 (GRCm39) nonsense probably null
R0130:Chd3 UTSW 11 69,250,656 (GRCm39) missense probably damaging 1.00
R0309:Chd3 UTSW 11 69,247,844 (GRCm39) missense probably damaging 1.00
R0330:Chd3 UTSW 11 69,247,159 (GRCm39) missense probably damaging 1.00
R0449:Chd3 UTSW 11 69,248,367 (GRCm39) missense probably damaging 0.98
R0502:Chd3 UTSW 11 69,244,931 (GRCm39) missense probably damaging 0.98
R0540:Chd3 UTSW 11 69,235,184 (GRCm39) missense probably damaging 0.98
R0571:Chd3 UTSW 11 69,252,495 (GRCm39) critical splice donor site probably null
R0607:Chd3 UTSW 11 69,235,184 (GRCm39) missense probably damaging 0.98
R0616:Chd3 UTSW 11 69,236,313 (GRCm39) missense probably damaging 0.96
R0630:Chd3 UTSW 11 69,238,021 (GRCm39) missense probably damaging 1.00
R1436:Chd3 UTSW 11 69,248,400 (GRCm39) splice site probably null
R1484:Chd3 UTSW 11 69,250,725 (GRCm39) missense probably benign 0.17
R1741:Chd3 UTSW 11 69,246,480 (GRCm39) missense probably damaging 1.00
R1748:Chd3 UTSW 11 69,255,523 (GRCm39) missense possibly damaging 0.81
R1751:Chd3 UTSW 11 69,244,727 (GRCm39) unclassified probably benign
R1833:Chd3 UTSW 11 69,244,949 (GRCm39) missense probably damaging 1.00
R2012:Chd3 UTSW 11 69,239,878 (GRCm39) missense probably benign 0.01
R2101:Chd3 UTSW 11 69,239,877 (GRCm39) missense probably benign
R2147:Chd3 UTSW 11 69,239,854 (GRCm39) missense probably benign 0.00
R2513:Chd3 UTSW 11 69,251,471 (GRCm39) missense probably damaging 1.00
R2877:Chd3 UTSW 11 69,251,998 (GRCm39) nonsense probably null
R2879:Chd3 UTSW 11 69,254,924 (GRCm39) missense possibly damaging 0.52
R2880:Chd3 UTSW 11 69,242,946 (GRCm39) missense probably damaging 1.00
R2881:Chd3 UTSW 11 69,242,946 (GRCm39) missense probably damaging 1.00
R2973:Chd3 UTSW 11 69,251,442 (GRCm39) missense probably damaging 1.00
R3611:Chd3 UTSW 11 69,252,973 (GRCm39) missense possibly damaging 0.53
R3743:Chd3 UTSW 11 69,254,876 (GRCm39) nonsense probably null
R3845:Chd3 UTSW 11 69,237,585 (GRCm39) missense possibly damaging 0.65
R3889:Chd3 UTSW 11 69,250,011 (GRCm39) missense probably damaging 0.98
R4007:Chd3 UTSW 11 69,239,827 (GRCm39) missense probably benign
R4115:Chd3 UTSW 11 69,248,343 (GRCm39) missense possibly damaging 0.95
R4515:Chd3 UTSW 11 69,240,703 (GRCm39) missense probably benign 0.00
R4612:Chd3 UTSW 11 69,244,035 (GRCm39) nonsense probably null
R4622:Chd3 UTSW 11 69,239,834 (GRCm39) missense probably damaging 0.98
R4634:Chd3 UTSW 11 69,253,013 (GRCm39) unclassified probably benign
R4635:Chd3 UTSW 11 69,253,013 (GRCm39) unclassified probably benign
R4859:Chd3 UTSW 11 69,250,722 (GRCm39) missense possibly damaging 0.79
R4930:Chd3 UTSW 11 69,245,034 (GRCm39) unclassified probably benign
R5173:Chd3 UTSW 11 69,260,069 (GRCm39) unclassified probably benign
R5403:Chd3 UTSW 11 69,239,895 (GRCm39) splice site probably null
R5511:Chd3 UTSW 11 69,252,301 (GRCm39) missense probably damaging 1.00
R5666:Chd3 UTSW 11 69,244,177 (GRCm39) missense possibly damaging 0.83
R5702:Chd3 UTSW 11 69,252,261 (GRCm39) missense possibly damaging 0.46
R6045:Chd3 UTSW 11 69,242,944 (GRCm39) missense possibly damaging 0.90
R6063:Chd3 UTSW 11 69,240,063 (GRCm39) missense probably benign
R6211:Chd3 UTSW 11 69,243,503 (GRCm39) missense probably damaging 1.00
R6215:Chd3 UTSW 11 69,247,380 (GRCm39) missense probably damaging 1.00
R6217:Chd3 UTSW 11 69,236,361 (GRCm39) missense probably damaging 1.00
R6302:Chd3 UTSW 11 69,244,604 (GRCm39) missense probably damaging 0.98
R6329:Chd3 UTSW 11 69,252,510 (GRCm39) missense possibly damaging 0.70
R6349:Chd3 UTSW 11 69,254,857 (GRCm39) missense possibly damaging 0.50
R6414:Chd3 UTSW 11 69,243,371 (GRCm39) critical splice donor site probably null
R6453:Chd3 UTSW 11 69,240,938 (GRCm39) nonsense probably null
R6548:Chd3 UTSW 11 69,252,886 (GRCm39) nonsense probably null
R6582:Chd3 UTSW 11 69,259,982 (GRCm39) unclassified probably benign
R6721:Chd3 UTSW 11 69,260,045 (GRCm39) unclassified probably benign
R6776:Chd3 UTSW 11 69,245,296 (GRCm39) missense probably damaging 1.00
R6900:Chd3 UTSW 11 69,245,271 (GRCm39) missense possibly damaging 0.64
R7085:Chd3 UTSW 11 69,260,027 (GRCm39) missense unknown
R7136:Chd3 UTSW 11 69,239,264 (GRCm39) missense probably null 0.37
R7164:Chd3 UTSW 11 69,253,132 (GRCm39) missense probably damaging 1.00
R7200:Chd3 UTSW 11 69,254,921 (GRCm39) missense possibly damaging 0.94
R7226:Chd3 UTSW 11 69,260,037 (GRCm39) missense unknown
R7238:Chd3 UTSW 11 69,254,873 (GRCm39) missense probably benign 0.31
R7316:Chd3 UTSW 11 69,236,394 (GRCm39) missense probably damaging 0.99
R7560:Chd3 UTSW 11 69,247,096 (GRCm39) missense probably damaging 1.00
R7684:Chd3 UTSW 11 69,248,692 (GRCm39) missense possibly damaging 0.83
R7748:Chd3 UTSW 11 69,246,459 (GRCm39) missense probably benign 0.00
R7820:Chd3 UTSW 11 69,244,064 (GRCm39) missense probably damaging 1.00
R7885:Chd3 UTSW 11 69,247,451 (GRCm39) missense probably benign 0.13
R8150:Chd3 UTSW 11 69,254,510 (GRCm39) missense probably benign 0.02
R8161:Chd3 UTSW 11 69,241,711 (GRCm39) missense probably damaging 1.00
R8271:Chd3 UTSW 11 69,251,483 (GRCm39) missense probably damaging 1.00
R8334:Chd3 UTSW 11 69,241,622 (GRCm39) missense probably damaging 1.00
R8423:Chd3 UTSW 11 69,245,252 (GRCm39) nonsense probably null
R8690:Chd3 UTSW 11 69,246,648 (GRCm39) critical splice acceptor site probably benign
R8828:Chd3 UTSW 11 69,247,097 (GRCm39) missense probably damaging 1.00
R8857:Chd3 UTSW 11 69,253,146 (GRCm39) missense probably benign 0.22
R9124:Chd3 UTSW 11 69,260,162 (GRCm39) missense unknown
R9170:Chd3 UTSW 11 69,241,648 (GRCm39) missense possibly damaging 0.64
R9213:Chd3 UTSW 11 69,255,628 (GRCm39) missense possibly damaging 0.53
R9285:Chd3 UTSW 11 69,249,954 (GRCm39) missense possibly damaging 0.64
R9293:Chd3 UTSW 11 69,244,027 (GRCm39) missense possibly damaging 0.94
R9368:Chd3 UTSW 11 69,251,200 (GRCm39) missense probably damaging 1.00
R9521:Chd3 UTSW 11 69,249,133 (GRCm39) missense probably benign 0.01
R9544:Chd3 UTSW 11 69,241,046 (GRCm39) missense probably damaging 1.00
R9554:Chd3 UTSW 11 69,251,015 (GRCm39) missense probably damaging 1.00
R9588:Chd3 UTSW 11 69,241,046 (GRCm39) missense probably damaging 1.00
X0022:Chd3 UTSW 11 69,247,084 (GRCm39) missense probably damaging 1.00
X0062:Chd3 UTSW 11 69,245,271 (GRCm39) missense possibly damaging 0.64
Z1186:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1186:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1187:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1187:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1188:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1188:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1189:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1189:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1190:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1190:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1191:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1191:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1192:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1192:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTACTCTCACCCCAAGTGCAG -3'
(R):5'- GCTGGACAAGGATGACACTG -3'

Sequencing Primer
(F):5'- TCACCCCAAGTGCAGAAGAGG -3'
(R):5'- ACAAGGATGACACTGAGAACC -3'
Posted On 2016-08-04