Incidental Mutation 'R5287:Ptprn2'
ID 424426
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
MMRRC Submission 042871-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R5287 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117175482 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 721 (M721L)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect possibly damaging
Transcript: ENSMUST00000070733
AA Change: M721L

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: M721L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190247
AA Change: M721L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: M721L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Meta Mutation Damage Score 0.3549 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T C 2: 93,666,298 (GRCm39) D463G probably damaging Het
Acsbg3 G T 17: 57,183,221 (GRCm39) probably benign Het
Adcy8 C T 15: 64,588,001 (GRCm39) V929I probably benign Het
Anp32a A T 9: 62,249,275 (GRCm39) I16F possibly damaging Het
Arpin T C 7: 79,577,997 (GRCm39) E144G probably damaging Het
Asb18 T C 1: 89,942,110 (GRCm39) T64A probably benign Het
Asxl2 A G 12: 3,546,893 (GRCm39) N559S probably benign Het
Brd7 G T 8: 89,084,169 (GRCm39) Q148K probably damaging Het
Brinp1 A G 4: 68,711,201 (GRCm39) W336R probably benign Het
Btnl9 A G 11: 49,060,434 (GRCm39) V438A probably benign Het
Cat T C 2: 103,304,705 (GRCm39) T107A probably damaging Het
Catsperg2 T C 7: 29,397,263 (GRCm39) Y1080C possibly damaging Het
Ccdc138 T A 10: 58,411,527 (GRCm39) F632I possibly damaging Het
Cd46 C T 1: 194,744,719 (GRCm39) V340I possibly damaging Het
Celf1 T C 2: 90,839,552 (GRCm39) S326P possibly damaging Het
Ces1e T G 8: 93,935,240 (GRCm39) D404A probably benign Het
Chd3 A T 11: 69,239,895 (GRCm39) probably null Het
Clhc1 A G 11: 29,528,244 (GRCm39) probably benign Het
Cops8 C T 1: 90,534,342 (GRCm39) probably benign Het
Cpox G A 16: 58,495,649 (GRCm39) G322D probably damaging Het
Csmd2 C T 4: 128,380,677 (GRCm39) R2078C probably benign Het
Dnm1l A C 16: 16,151,732 (GRCm39) V240G probably damaging Het
Fezf1 C T 6: 23,248,010 (GRCm39) V22M probably benign Het
Gm6818 T G 7: 38,099,911 (GRCm39) noncoding transcript Het
Hand2 C T 8: 57,775,080 (GRCm39) L47F probably damaging Het
Insyn2b A T 11: 34,353,058 (GRCm39) T367S probably benign Het
Itga7 C A 10: 128,779,027 (GRCm39) R351S probably benign Het
Mmp8 G T 9: 7,567,507 (GRCm39) A456S probably benign Het
Mroh5 TGGAG TG 15: 73,654,923 (GRCm39) probably benign Het
Opn4 T C 14: 34,314,894 (GRCm39) T460A probably benign Het
Or6b2 A T 1: 92,408,019 (GRCm39) V108E possibly damaging Het
Otog T C 7: 45,918,753 (GRCm39) F943S probably damaging Het
Pcnx1 A T 12: 82,028,825 (GRCm39) Y1668F probably damaging Het
Pheta1 A G 5: 121,990,794 (GRCm39) E52G possibly damaging Het
Phf24 A T 4: 42,933,831 (GRCm39) probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,181,929 (GRCm39) probably null Het
Ppargc1a G A 5: 51,620,167 (GRCm39) probably benign Het
Ptprd G A 4: 75,872,405 (GRCm39) R1355* probably null Het
Sec23ip A G 7: 128,367,860 (GRCm39) E624G probably benign Het
Sfmbt1 G A 14: 30,538,777 (GRCm39) V799M probably damaging Het
Snrnp200 T C 2: 127,073,607 (GRCm39) V1335A probably benign Het
Sp140 G A 1: 85,538,545 (GRCm39) probably null Het
Spdye4c T C 2: 128,434,560 (GRCm39) S46P possibly damaging Het
Syde1 T C 10: 78,425,871 (GRCm39) R99G probably benign Het
T2 A T 17: 8,636,835 (GRCm39) M57L probably benign Het
Tasor2 G A 13: 3,625,744 (GRCm39) S1402L probably benign Het
Tfap2e T C 4: 126,628,439 (GRCm39) I172M probably benign Het
Tk1 A T 11: 117,707,367 (GRCm39) V140E probably damaging Het
Tln2 G A 9: 67,149,641 (GRCm39) T1192M probably damaging Het
Tmed8 C A 12: 87,220,957 (GRCm39) A210S probably damaging Het
Tnip2 A G 5: 34,671,108 (GRCm39) L45P probably damaging Het
Ttc3 T C 16: 94,260,703 (GRCm39) V1396A probably benign Het
Ttn G T 2: 76,562,436 (GRCm39) S28803Y probably damaging Het
Wdr90 A T 17: 26,080,441 (GRCm39) probably benign Het
Zfp7 G A 15: 76,775,422 (GRCm39) R488Q probably damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTAGCCTGTCAGGGAGCTAC -3'
(R):5'- GTAAATCACAGCCAGGTGTCCC -3'

Sequencing Primer
(F):5'- GGGAGCTACCTGCCTTCTCTAG -3'
(R):5'- CTCCTCTCCCCCTGCTAGG -3'
Posted On 2016-08-04