Incidental Mutation 'R5287:Ptprn2'
ID424426
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Nameprotein tyrosine phosphatase, receptor type, N polypeptide 2
Synonymsphogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5287 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location116485720-117276849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117211862 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 721 (M721L)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070733
AA Change: M721L

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: M721L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190247
AA Change: M721L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: M721L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Btnl9 A G 11: 49,169,607 V438A probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Celf1 T C 2: 91,009,207 S326P possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Clhc1 A G 11: 29,578,244 probably benign Het
Cops8 C T 1: 90,606,620 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Hand2 C T 8: 57,322,045 L47F probably damaging Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mmp8 G T 9: 7,567,506 A456S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Spdye4c T C 2: 128,592,640 S46P possibly damaging Het
Syde1 T C 10: 78,590,037 R99G probably benign Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tk1 A T 11: 117,816,541 V140E probably damaging Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116841388 missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116900987 missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116873697 splice site probably benign
IGL02339:Ptprn2 APN 12 116722104 missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116888898 missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117211943 missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116876344 nonsense probably null
IGL03014:Ptprn2 UTSW 12 117248688 missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117211846 splice site probably benign
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117211846 splice site probably benign
R0694:Ptprn2 UTSW 12 116824355 missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116722130 nonsense probably null
R0746:Ptprn2 UTSW 12 116901017 missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117212008 splice site probably null
R1443:Ptprn2 UTSW 12 117253615 missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117184722 missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117161709 missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116722172 missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116580428 missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117247717 missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116722133 missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116888877 missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116901008 missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116876000 missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116872094 missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116824396 missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117247773 nonsense probably null
R4872:Ptprn2 UTSW 12 117161694 missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117233365 splice site probably null
R4970:Ptprn2 UTSW 12 117276595 missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116858928 missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117184647 missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116859119 missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117269589 missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116872038 missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117227200 missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116888888 missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116872056 missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117227225 splice site probably null
R7237:Ptprn2 UTSW 12 117161727 missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117248544 missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116858951 missense probably benign
R7460:Ptprn2 UTSW 12 117248681 missense probably benign 0.05
X0066:Ptprn2 UTSW 12 117161760 missense probably damaging 1.00
X0066:Ptprn2 UTSW 12 117184740 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACTTAGCCTGTCAGGGAGCTAC -3'
(R):5'- GTAAATCACAGCCAGGTGTCCC -3'

Sequencing Primer
(F):5'- GGGAGCTACCTGCCTTCTCTAG -3'
(R):5'- CTCCTCTCCCCCTGCTAGG -3'
Posted On2016-08-04