Incidental Mutation 'R5287:Cpox'
ID424434
Institutional Source Beutler Lab
Gene Symbol Cpox
Ensembl Gene ENSMUSG00000022742
Gene Namecoproporphyrinogen oxidase
Synonymsnct, Cpo, cac, clone 560
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R5287 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58670292-58717636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58675286 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 322 (G322D)
Ref Sequence ENSEMBL: ENSMUSP00000055455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060077]
Predicted Effect probably damaging
Transcript: ENSMUST00000060077
AA Change: G322D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055455
Gene: ENSMUSG00000022742
AA Change: G322D

DomainStartEndE-ValueType
low complexity region 57 81 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:Coprogen_oxidas 140 442 7.6e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232532
Meta Mutation Damage Score 0.9743 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the sixth enzyme of the heme biosynthetic pathway. The encoded enzyme is soluble and found in the intermembrane space of mitochondria. This enzyme catalyzes the stepwise oxidative decarboxylation of coproporphyrinogen III to protoporphyrinogen IX, a precursor of heme. Defects in this gene are a cause of hereditary coproporphyria (HCP).[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a spontaneous allele develop cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Btnl9 A G 11: 49,169,607 V438A probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Celf1 T C 2: 91,009,207 S326P possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Clhc1 A G 11: 29,578,244 probably benign Het
Cops8 C T 1: 90,606,620 probably benign Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Hand2 C T 8: 57,322,045 L47F probably damaging Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mmp8 G T 9: 7,567,506 A456S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Ptprn2 A T 12: 117,211,862 M721L probably damaging Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Spdye4c T C 2: 128,592,640 S46P possibly damaging Het
Syde1 T C 10: 78,590,037 R99G probably benign Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tk1 A T 11: 117,816,541 V140E probably damaging Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Cpox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Cpox APN 16 58674424 missense possibly damaging 0.87
IGL03031:Cpox APN 16 58672560 missense probably damaging 1.00
IGL03034:Cpox APN 16 58675355 missense probably damaging 0.98
scraggy UTSW 16 58670935 missense probably damaging 1.00
R0413:Cpox UTSW 16 58670869 missense possibly damaging 0.52
R0523:Cpox UTSW 16 58675245 nonsense probably null
R0551:Cpox UTSW 16 58675390 missense probably benign 0.11
R2064:Cpox UTSW 16 58674409 missense probably benign 0.36
R4651:Cpox UTSW 16 58670687 missense possibly damaging 0.92
R4701:Cpox UTSW 16 58677969 nonsense probably null
R4782:Cpox UTSW 16 58672623 missense probably damaging 1.00
R5285:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5313:Cpox UTSW 16 58677948 nonsense probably null
R5346:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5354:Cpox UTSW 16 58670842 missense probably damaging 0.99
R5404:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5476:Cpox UTSW 16 58678725 missense probably damaging 0.99
R5853:Cpox UTSW 16 58675417 missense probably damaging 0.99
R6026:Cpox UTSW 16 58670935 missense probably damaging 1.00
R7059:Cpox UTSW 16 58670927 missense probably damaging 1.00
R7061:Cpox UTSW 16 58670860 missense possibly damaging 0.76
R7606:Cpox UTSW 16 58674449 missense probably benign 0.16
RF059:Cpox UTSW 16 58670767 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAAGTCTGGCTAGAGTCCTC -3'
(R):5'- GTGTAGACTGTTCACCCTCC -3'

Sequencing Primer
(F):5'- CCTCGTTTTGTAGTCCTAGAGAAAAC -3'
(R):5'- GTAGACTGTTCACCCTCCTGTCAC -3'
Posted On2016-08-04