Mutagenetix > Incidental Mutation

Incidental Mutation 'R5288:Stard9'

424452

Institutional Source

Beutler Lab

Gene Symbol

Stard9

Ensembl Gene

ENSMUSG00000033705

Gene Name

START domain containing 9

Synonyms

E230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin

MMRRC Submission

042842-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R5288 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120629121-120731895 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120700630 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2456 (E2456G)

Ref Sequence

ENSEMBL: ENSMUSP00000136055 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000070420

SMART Domains

Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
coiled coil region	97	138	N/A	INTRINSIC
low complexity region	142	151	N/A	INTRINSIC
low complexity region	157	174	N/A	INTRINSIC
low complexity region	234	255	N/A	INTRINSIC
Pfam:START	274	469	3.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140843

SMART Domains

Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
FHA	63	115	2.8e-4	SMART
coiled coil region	334	354	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	866	871	N/A	INTRINSIC
low complexity region	1023	1035	N/A	INTRINSIC
low complexity region	1234	1248	N/A	INTRINSIC
low complexity region	1765	1775	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2953	2963	N/A	INTRINSIC
low complexity region	3269	3281	N/A	INTRINSIC
low complexity region	3421	3435	N/A	INTRINSIC
coiled coil region	3767	3808	N/A	INTRINSIC
low complexity region	3812	3821	N/A	INTRINSIC
low complexity region	3827	3844	N/A	INTRINSIC
low complexity region	3904	3925	N/A	INTRINSIC
SCOP:d1jssa_	3946	4142	1e-28	SMART
Blast:START	3947	4143	1e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000154193

SMART Domains

Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC
coiled coil region	409	450	N/A	INTRINSIC
low complexity region	454	463	N/A	INTRINSIC
low complexity region	469	486	N/A	INTRINSIC
low complexity region	546	567	N/A	INTRINSIC
SCOP:d1jssa_	588	784	4e-29	SMART
Blast:START	589	785	6e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000180041
AA Change: E2456G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: E2456G

Domain	Start	End	E-Value	Type
KISc	1	392	3.31e-143	SMART
low complexity region	398	409	N/A	INTRINSIC
FHA	481	533	2.8e-4	SMART
coiled coil region	752	772	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
low complexity region	1284	1289	N/A	INTRINSIC
low complexity region	1441	1453	N/A	INTRINSIC
low complexity region	1652	1666	N/A	INTRINSIC
low complexity region	2183	2193	N/A	INTRINSIC
low complexity region	2964	2977	N/A	INTRINSIC
low complexity region	3371	3381	N/A	INTRINSIC
low complexity region	3687	3699	N/A	INTRINSIC
low complexity region	3839	3853	N/A	INTRINSIC
coiled coil region	4185	4226	N/A	INTRINSIC
low complexity region	4230	4239	N/A	INTRINSIC
low complexity region	4245	4262	N/A	INTRINSIC
low complexity region	4322	4343	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110001I22Rik	T	G	16: 13,677,758	N240K	probably benign	Het
Abcc12	A	T	8: 86,566,539	Y7N	probably damaging	Het
Adcy1	A	C	11: 7,161,351	I881L	probably benign	Het
Aftph	T	C	11: 20,726,994	D205G	probably damaging	Het
Aldh7a1	T	A	18: 56,534,253	N316Y	possibly damaging	Het
Ankrd36	A	G	11: 5,689,340		probably benign	Het
C87414	C	T	5: 93,637,748	M224I	possibly damaging	Het
Ccdc88a	T	G	11: 29,498,416	N1465K	possibly damaging	Het
Ccpg1	G	A	9: 73,013,044	S647N	probably benign	Het
Cep70	T	A	9: 99,281,075	L325Q	probably damaging	Het
Cfap46	A	G	7: 139,613,507		probably null	Het
Cftr	C	T	6: 18,226,129	Q359*	probably null	Het
Chrne	A	T	11: 70,615,087	N457K	possibly damaging	Het
Cntn2	A	G	1: 132,523,677	I438T	probably benign	Het
Cntn4	T	C	6: 106,181,804	L10P	possibly damaging	Het
Copg1	G	T	6: 87,890,207	M87I	possibly damaging	Het
Cyfip1	A	T	7: 55,925,135	M1045L	possibly damaging	Het
Cyp2c29	C	T	19: 39,330,372	P432L	probably damaging	Het
Dcaf11	T	A	14: 55,563,376	D96E	probably damaging	Het
Dmxl2	A	G	9: 54,378,757	S2715P	probably benign	Het
Dnhd1	G	A	7: 105,714,437	E4069K	possibly damaging	Het
Dpy19l4	T	A	4: 11,289,721	N330I	probably damaging	Het
Dpy19l4	G	T	4: 11,304,014	A132D	probably damaging	Het
Duox2	A	G	2: 122,295,136	V330A	probably benign	Het
Dusp11	T	C	6: 85,947,605	*322W	probably null	Het
Dusp8	T	A	7: 142,089,993	Q61L	possibly damaging	Het
Eml3	G	A	19: 8,939,274	G720S	probably damaging	Het
F11	A	G	8: 45,246,796	S418P	probably damaging	Het
Fam91a1	G	A	15: 58,448,394	S645N	probably benign	Het
Fat2	G	A	11: 55,267,656	T3412I	probably benign	Het
Fbxo38	A	G	18: 62,540,971	M13T	probably benign	Het
Fbxo48	G	T	11: 16,954,329	L160F	possibly damaging	Het
Gm10134	T	A	2: 28,506,360		probably benign	Het
Gm11787	T	C	4: 3,511,795		noncoding transcript	Het
Gm14085	C	A	2: 122,522,778	L480I	probably benign	Het
Gpatch8	A	T	11: 102,508,227		probably null	Het
Gucy2g	G	A	19: 55,215,116	A750V	probably damaging	Het
Hephl1	T	C	9: 15,076,854	T653A	possibly damaging	Het
Herc3	T	A	6: 58,874,278	M504K	probably damaging	Het
Hmcn2	A	G	2: 31,460,321	T5077A	probably benign	Het
Ifitm3	T	C	7: 141,010,641	N2S	probably benign	Het
Ighe	T	C	12: 113,271,472	H356R	probably benign	Het
Ighv10-3	T	A	12: 114,523,505	M99L	probably benign	Het
Izumo4	C	A	10: 80,702,805	C30*	probably null	Het
Jag1	A	T	2: 137,095,544	H303Q	possibly damaging	Het
Kif24	T	C	4: 41,395,373	E500G	probably benign	Het
Kng1	A	T	16: 23,079,092	D414V	probably damaging	Het
Loxhd1	A	C	18: 77,363,612	D410A	probably damaging	Het
Ltn1	T	C	16: 87,416,011	K554R	possibly damaging	Het
Ly75	A	G	2: 60,303,641	C1547R	probably damaging	Het
Ms4a6d	A	T	19: 11,587,136	S124T	possibly damaging	Het
Mtfr2	A	G	10: 20,357,702	D339G	probably damaging	Het
Myh10	T	A	11: 68,801,608	L1369Q	probably damaging	Het
Myh11	A	T	16: 14,208,008	V1366D	possibly damaging	Het
Nadsyn1	A	G	7: 143,803,286	V491A	possibly damaging	Het
Nav3	T	C	10: 109,853,105	N437S	probably benign	Het
Ncf1	A	G	5: 134,221,805	L373P	probably damaging	Het
Neb	A	T	2: 52,189,861	I85N	probably damaging	Het
Nktr	A	G	9: 121,748,593	K576E	probably benign	Het
Nmur2	T	A	11: 56,040,214	I224F	probably damaging	Het
Oas3	A	G	5: 120,756,990	F978S	probably damaging	Het
Olfr1115	C	T	2: 87,252,483	P182L	probably benign	Het
Olfr1331	T	C	4: 118,869,575	S264P	probably damaging	Het
Olfr330	A	T	11: 58,529,482	M168K	probably damaging	Het
Olfr457	T	A	6: 42,471,252	I309F	probably benign	Het
Olfr484	T	C	7: 108,125,168	T32A	probably benign	Het
Pcyox1	A	T	6: 86,392,354		probably null	Het
Pdcd7	G	A	9: 65,358,692	W477*	probably null	Het
Pitpnm1	T	C	19: 4,103,435	F197S	probably damaging	Het
Plce1	C	A	19: 38,760,091	N1755K	probably damaging	Het
Pnpla7	C	A	2: 25,041,019	P882Q	probably damaging	Het
Pold2	A	G	11: 5,876,760	L58P	probably damaging	Het
Pomt1	C	G	2: 32,244,299	Y277*	probably null	Het
Pou4f2	A	G	8: 78,436,329	Y26H	unknown	Het
Ppm1e	A	T	11: 87,358,551	L118Q	possibly damaging	Het
Prdx2	T	A	8: 84,971,673	Y164*	probably null	Het
Prkra	T	G	2: 76,639,278	T146P	probably damaging	Het
Prpf8	A	G	11: 75,495,799	D1038G	probably damaging	Het
Rab4a	A	T	8: 123,827,374	I16L	probably benign	Het
Rai2	A	G	X: 161,778,640	N363S	probably benign	Het
Ranbp17	A	T	11: 33,219,241	V991D	possibly damaging	Het
Rimbp2	G	A	5: 128,788,592	T557M	probably benign	Het
Rmi1	G	A	13: 58,409,466	G510R	probably damaging	Het
Sdad1	A	G	5: 92,286,825	*687Q	probably null	Het
Sema6d	T	C	2: 124,664,246	L720P	probably damaging	Het
Setx	T	G	2: 29,134,033		probably null	Het
Sgsm3	T	C	15: 81,007,999	V256A	probably benign	Het
Soga3	A	G	10: 29,196,770	D686G	probably benign	Het
Sppl2c	T	A	11: 104,187,301	I309K	possibly damaging	Het
Strn3	C	G	12: 51,648,020	R320P	probably damaging	Het
Supv3l1	A	T	10: 62,430,596	N600K	possibly damaging	Het
Syne2	T	A	12: 76,099,338	S6377T	possibly damaging	Het
Tas2r123	A	T	6: 132,847,227	H29L	probably benign	Het
Tbl3	C	T	17: 24,705,970	V52M	possibly damaging	Het
Tbp	A	G	17: 15,507,347	I145V	probably benign	Het
Tcf20	A	T	15: 82,855,709	S514T	possibly damaging	Het
Tgm4	A	G	9: 123,056,494	Y367C	probably damaging	Het
Tle1	C	T	4: 72,141,844	V258M	probably damaging	Het
Tln1	C	T	4: 43,540,661	V1447I	probably benign	Het
Tnfrsf11b	C	T	15: 54,278,226	A8T	probably benign	Het
Trim80	A	T	11: 115,448,017	T558S	probably benign	Het
Trmt6	C	A	2: 132,808,783	A302S	probably benign	Het
Tsen15	C	T	1: 152,383,380	V76I	probably damaging	Het
Ttc17	A	T	2: 94,303,640	W1067R	probably damaging	Het
Ucn3	A	T	13: 3,941,474	F59L	probably benign	Het
Ulk3	T	A	9: 57,590,740	I108N	possibly damaging	Het
Vmn2r94	A	C	17: 18,244,466	Y521D	probably damaging	Het
Vps45	T	C	3: 96,057,774	M1V	probably null	Het
Vta1	C	A	10: 14,705,399	L21F	probably damaging	Het
Zdhhc21	C	T	4: 82,847,692	G2D	probably damaging	Het
Zfp169	A	T	13: 48,490,275	C459S	possibly damaging	Het
Zfp90	C	T	8: 106,425,368	T571M	probably damaging	Het
Zswim8	A	T	14: 20,718,871	N1119I	possibly damaging	Het

Other mutations in Stard9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Stard9	APN	2	120701847	missense	possibly damaging	0.52
IGL01122:Stard9	APN	2	120698479	missense	possibly damaging	0.93
IGL01318:Stard9	APN	2	120698719	missense	possibly damaging	0.56
IGL01371:Stard9	APN	2	120701368	missense	probably benign	0.04
IGL01394:Stard9	APN	2	120706327	missense	possibly damaging	0.78
IGL01531:Stard9	APN	2	120673604	missense	possibly damaging	0.93
IGL01721:Stard9	APN	2	120703330	missense	probably damaging	1.00
IGL01810:Stard9	APN	2	120699084	missense	possibly damaging	0.95
IGL01829:Stard9	APN	2	120706446	missense	possibly damaging	0.59
IGL01916:Stard9	APN	2	120668016	missense	probably damaging	1.00
IGL02031:Stard9	APN	2	120702339	missense	probably benign	0.27
IGL02081:Stard9	APN	2	120664910	missense	probably damaging	0.98
IGL02558:Stard9	APN	2	120696907	missense	possibly damaging	0.95
IGL02646:Stard9	APN	2	120698992	missense	probably damaging	1.00
IGL02873:Stard9	APN	2	120713807	missense	probably damaging	1.00
IGL03195:Stard9	APN	2	120705802	missense	probably damaging	1.00
IGL03204:Stard9	APN	2	120705802	missense	probably damaging	1.00
FR4737:Stard9	UTSW	2	120696085	small insertion	probably benign
IGL03014:Stard9	UTSW	2	120702194	unclassified	probably benign
PIT4151001:Stard9	UTSW	2	120702756	nonsense	probably null
PIT4498001:Stard9	UTSW	2	120697435	missense	possibly damaging	0.86
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0038:Stard9	UTSW	2	120695832	missense	probably benign
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0116:Stard9	UTSW	2	120634255	missense	probably damaging	0.99
R0398:Stard9	UTSW	2	120696307	missense	probably benign	0.03
R0479:Stard9	UTSW	2	120697596	missense	probably damaging	1.00
R0556:Stard9	UTSW	2	120698923	missense	probably benign	0.09
R0589:Stard9	UTSW	2	120698547	missense	probably benign	0.00
R0609:Stard9	UTSW	2	120706306	missense	probably damaging	1.00
R0611:Stard9	UTSW	2	120699257	missense	probably benign	0.00
R0683:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0751:Stard9	UTSW	2	120697485	missense	probably benign	0.04
R0833:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0836:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0838:Stard9	UTSW	2	120700842	missense	probably damaging	1.00
R0848:Stard9	UTSW	2	120695823	missense	probably damaging	1.00
R0849:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0961:Stard9	UTSW	2	120693439	missense	probably benign	0.01
R0993:Stard9	UTSW	2	120705169	missense	probably damaging	1.00
R1005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1006:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1115:Stard9	UTSW	2	120692850	missense	probably benign	0.05
R1163:Stard9	UTSW	2	120696213	missense	possibly damaging	0.86
R1199:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1200:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1331:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1332:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1333:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1334:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1335:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1336:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1338:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1346:Stard9	UTSW	2	120713448	missense	probably damaging	1.00
R1370:Stard9	UTSW	2	120697477	missense	probably benign	0.11
R1384:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1401:Stard9	UTSW	2	120712847	splice site	probably benign
R1416:Stard9	UTSW	2	120700972	missense	probably benign	0.00
R1453:Stard9	UTSW	2	120666376	missense	probably damaging	1.00
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1525:Stard9	UTSW	2	120702052	missense	probably benign	0.09
R1538:Stard9	UTSW	2	120696711	missense	probably benign	0.25
R1614:Stard9	UTSW	2	120697675	missense	possibly damaging	0.95
R1654:Stard9	UTSW	2	120703722	missense	probably benign	0.37
R1658:Stard9	UTSW	2	120701542	missense	probably benign	0.02
R1686:Stard9	UTSW	2	120699492	missense	probably benign	0.00
R1797:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1803:Stard9	UTSW	2	120701489	missense	probably benign	0.24
R1806:Stard9	UTSW	2	120679453	splice site	probably null
R1847:Stard9	UTSW	2	120698489	missense	possibly damaging	0.51
R1853:Stard9	UTSW	2	120688751	missense	probably damaging	1.00
R1892:Stard9	UTSW	2	120693708	missense	probably benign	0.01
R1906:Stard9	UTSW	2	120696427	missense	probably benign	0.00
R1907:Stard9	UTSW	2	120713812	missense	probably damaging	1.00
R1930:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1933:Stard9	UTSW	2	120698656	missense	possibly damaging	0.55
R1989:Stard9	UTSW	2	120701406	missense	probably benign
R1999:Stard9	UTSW	2	120692868	missense	probably damaging	0.99
R2004:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2005:Stard9	UTSW	2	120664945	missense	possibly damaging	0.90
R2005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2021:Stard9	UTSW	2	120704235	missense	probably benign	0.05
R2025:Stard9	UTSW	2	120702398	missense	probably benign	0.20
R2190:Stard9	UTSW	2	120714120	missense	probably benign	0.22
R2204:Stard9	UTSW	2	120698531	frame shift	probably null
R2422:Stard9	UTSW	2	120700284	missense	probably benign	0.29
R3401:Stard9	UTSW	2	120703689	missense	probably damaging	0.98
R3618:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3619:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3900:Stard9	UTSW	2	120713549	missense	possibly damaging	0.93
R3943:Stard9	UTSW	2	120698229	missense	probably benign	0.11
R4022:Stard9	UTSW	2	120704155	missense	probably benign	0.05
R4223:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4224:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4225:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4345:Stard9	UTSW	2	120701946	missense	probably benign	0.43
R4382:Stard9	UTSW	2	120634222	missense	probably damaging	1.00
R4453:Stard9	UTSW	2	120697791	missense	probably benign
R4499:Stard9	UTSW	2	120700241	missense	probably benign	0.05
R4524:Stard9	UTSW	2	120696445	missense	probably damaging	1.00
R4671:Stard9	UTSW	2	120698640	missense	probably damaging	0.98
R4701:Stard9	UTSW	2	120705713	missense	possibly damaging	0.85
R4744:Stard9	UTSW	2	120696123	missense	probably benign	0.01
R4822:Stard9	UTSW	2	120695941	missense	possibly damaging	0.94
R4847:Stard9	UTSW	2	120703113	missense	probably benign	0.18
R4863:Stard9	UTSW	2	120700860	missense	probably benign	0.00
R4898:Stard9	UTSW	2	120706419	nonsense	probably null
R5033:Stard9	UTSW	2	120693399	missense	probably benign	0.00
R5087:Stard9	UTSW	2	120697019	nonsense	probably null
R5157:Stard9	UTSW	2	120697861	missense	probably benign
R5213:Stard9	UTSW	2	120699226	missense	probably damaging	1.00
R5237:Stard9	UTSW	2	120699358	missense	probably damaging	0.96
R5257:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5258:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5273:Stard9	UTSW	2	120705087	missense	possibly damaging	0.94
R5286:Stard9	UTSW	2	120701947	missense	probably benign	0.43
R5292:Stard9	UTSW	2	120699145	missense	probably benign	0.17
R5328:Stard9	UTSW	2	120699230	missense	probably damaging	1.00
R5385:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5386:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5393:Stard9	UTSW	2	120702906	missense	possibly damaging	0.87
R5405:Stard9	UTSW	2	120693668	missense	probably benign	0.17
R5685:Stard9	UTSW	2	120705322	missense	probably damaging	1.00
R5749:Stard9	UTSW	2	120703786	missense	probably damaging	1.00
R5780:Stard9	UTSW	2	120703396	missense	probably benign	0.02
R5901:Stard9	UTSW	2	120701370	missense	probably damaging	1.00
R5941:Stard9	UTSW	2	120713558	missense	probably damaging	1.00
R5960:Stard9	UTSW	2	120699961	missense	probably benign	0.05
R5966:Stard9	UTSW	2	120697099	missense	probably damaging	1.00
R5967:Stard9	UTSW	2	120706894	missense	probably damaging	0.99
R6012:Stard9	UTSW	2	120704586	missense	probably damaging	1.00
R6019:Stard9	UTSW	2	120693715	frame shift	probably null
R6020:Stard9	UTSW	2	120693715	frame shift	probably null
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6090:Stard9	UTSW	2	120693654	missense	probably damaging	0.99
R6192:Stard9	UTSW	2	120696760	missense	probably damaging	0.99
R6228:Stard9	UTSW	2	120713750	missense	probably damaging	1.00
R6235:Stard9	UTSW	2	120713546	missense	probably damaging	1.00
R6280:Stard9	UTSW	2	120701127	missense	probably benign
R6338:Stard9	UTSW	2	120697485	missense	probably benign
R6344:Stard9	UTSW	2	120704320	missense	probably benign	0.12
R6364:Stard9	UTSW	2	120713429	missense	probably damaging	1.00
R6383:Stard9	UTSW	2	120666407	critical splice donor site	probably null
R6644:Stard9	UTSW	2	120695772	missense	probably benign	0.11
R6747:Stard9	UTSW	2	120698383	missense	possibly damaging	0.62
R6833:Stard9	UTSW	2	120701259	missense	probably damaging	1.00
R6836:Stard9	UTSW	2	120699843	missense	probably benign	0.15
R6861:Stard9	UTSW	2	120705186	missense	probably benign	0.09
R6872:Stard9	UTSW	2	120714068	nonsense	probably null
R6875:Stard9	UTSW	2	120697436	missense	probably benign	0.04
R6915:Stard9	UTSW	2	120702630	missense	probably benign	0.00
R6934:Stard9	UTSW	2	120697695	missense	probably benign	0.00
R6943:Stard9	UTSW	2	120702196	missense	probably benign	0.29
R7009:Stard9	UTSW	2	120697191	missense	probably benign	0.37
R7031:Stard9	UTSW	2	120700450	missense	possibly damaging	0.61
R7132:Stard9	UTSW	2	120679378	nonsense	probably null
R7151:Stard9	UTSW	2	120696142	missense	probably benign
R7154:Stard9	UTSW	2	120701314	missense	probably benign	0.00
R7154:Stard9	UTSW	2	120704542	missense	probably benign	0.02
R7165:Stard9	UTSW	2	120704158	missense	probably damaging	1.00
R7260:Stard9	UTSW	2	120706938	missense	possibly damaging	0.90
R7270:Stard9	UTSW	2	120634274	nonsense	probably null
R7282:Stard9	UTSW	2	120698503	missense	probably benign	0.00
R7344:Stard9	UTSW	2	120704686	missense	possibly damaging	0.90
R7347:Stard9	UTSW	2	120666534	missense	probably benign
R7359:Stard9	UTSW	2	120698280	missense	probably damaging	1.00
R7375:Stard9	UTSW	2	120665002	splice site	probably null
R7410:Stard9	UTSW	2	120701497	missense	probably benign	0.41
R7422:Stard9	UTSW	2	120702152	missense	probably benign	0.21
R7475:Stard9	UTSW	2	120688110	missense	probably damaging	1.00
R7523:Stard9	UTSW	2	120699597	missense	probably benign
R7553:Stard9	UTSW	2	120693808	splice site	probably null
R7624:Stard9	UTSW	2	120688146	missense	probably benign	0.15
R7761:Stard9	UTSW	2	120699379	missense	probably benign	0.00
R7794:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R7819:Stard9	UTSW	2	120700984	missense	probably damaging	1.00
R7823:Stard9	UTSW	2	120702106	missense	probably damaging	0.96
R7837:Stard9	UTSW	2	120703665	missense	probably benign	0.06
R7889:Stard9	UTSW	2	120704461	missense	probably benign	0.11
R7905:Stard9	UTSW	2	120696081	missense	not run
R7956:Stard9	UTSW	2	120705371	nonsense	probably null
R8013:Stard9	UTSW	2	120688101	missense	probably damaging	1.00
R8113:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8114:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8116:Stard9	UTSW	2	120664939	nonsense	probably null
R8117:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8118:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8170:Stard9	UTSW	2	120700048	missense	possibly damaging	0.76
R8300:Stard9	UTSW	2	120704769	missense	possibly damaging	0.71
R8333:Stard9	UTSW	2	120701789	missense	probably benign	0.00
R8337:Stard9	UTSW	2	120679825	missense	probably damaging	1.00
R8536:Stard9	UTSW	2	120714659	missense	possibly damaging	0.93
R8682:Stard9	UTSW	2	120703315	missense	possibly damaging	0.65
R8696:Stard9	UTSW	2	120701114	missense	probably benign	0.02
R8708:Stard9	UTSW	2	120703578	missense	probably damaging	1.00
R8732:Stard9	UTSW	2	120679961	missense	probably damaging	1.00
R8798:Stard9	UTSW	2	120704731	missense	probably benign	0.09
R8807:Stard9	UTSW	2	120705451	missense	probably damaging	1.00
R8807:Stard9	UTSW	2	120705462	missense	probably damaging	1.00
R8862:Stard9	UTSW	2	120703618	missense	probably benign
R8920:Stard9	UTSW	2	120702607	missense	probably damaging	0.96
R9026:Stard9	UTSW	2	120705802	missense	probably damaging	1.00
R9048:Stard9	UTSW	2	120677934	missense	probably damaging	0.99
R9049:Stard9	UTSW	2	120679937	missense	probably benign	0.30
R9152:Stard9	UTSW	2	120698587	missense	probably damaging	0.99
R9189:Stard9	UTSW	2	120703019	missense	possibly damaging	0.95
R9238:Stard9	UTSW	2	120697966	missense	probably damaging	1.00
R9372:Stard9	UTSW	2	120664939	nonsense	probably null
R9393:Stard9	UTSW	2	120688175	missense	possibly damaging	0.88
R9444:Stard9	UTSW	2	120664933	missense	probably damaging	1.00
R9514:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9515:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9516:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9570:Stard9	UTSW	2	120704233	missense	probably benign	0.02
R9649:Stard9	UTSW	2	120696154	missense	probably benign	0.20
R9789:Stard9	UTSW	2	120679936	missense	probably damaging	1.00
X0023:Stard9	UTSW	2	120702744	missense	probably benign	0.00
X0023:Stard9	UTSW	2	120702963	missense	possibly damaging	0.92
Z1176:Stard9	UTSW	2	120695818	missense	probably benign	0.01
Z1176:Stard9	UTSW	2	120696612	missense	probably benign
Z1176:Stard9	UTSW	2	120698322	missense	probably damaging	1.00
Z1177:Stard9	UTSW	2	120673676	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGGGGACTTCAGAGATACCTC -3'
(R):5'- CTCATACGGAAGGACTGTCC -3'

Sequencing Primer
(F):5'- GGACTTCAGAGATACCTCCACAGG -3'
(R):5'- GCCACTAAGTCAGTAAGCTGCTTC -3'

Posted On

2016-08-04