Mutagenetix > Incidental Mutation

Incidental Mutation 'R0491:Atf6'

42446

Institutional Source

Beutler Lab

Gene Symbol

Atf6

Ensembl Gene

ENSMUSG00000026663

Gene Name

activating transcription factor 6

Synonyms

9130025P16Rik, ESTM49, Atf6alpha

MMRRC Submission

038689-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R0491 (G1)

Quality Score

198

Status

Validated

Chromosome

Chromosomal Location

170704674-170867771 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 170787344 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027974]

AlphaFold

F6VAN0

Predicted Effect

probably null
Transcript: ENSMUST00000027974

SMART Domains

Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663

Domain	Start	End	E-Value	Type
low complexity region	78	101	N/A	INTRINSIC
low complexity region	109	121	N/A	INTRINSIC
low complexity region	168	178	N/A	INTRINSIC
BRLZ	291	355	2.72e-16	SMART
Blast:BRLZ	384	419	5e-6	BLAST
low complexity region	445	457	N/A	INTRINSIC
low complexity region	631	650	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182787

Meta Mutation Damage Score

0.9504

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,182,243	S356T	probably damaging	Het
Abca13	T	C	11: 9,298,235	F2661L	probably benign	Het
Acadsb	A	G	7: 131,430,107	D224G	probably benign	Het
Acsm1	A	G	7: 119,640,697	H288R	probably damaging	Het
Adamts2	A	G	11: 50,776,630	D465G	probably damaging	Het
Akap9	A	T	5: 3,972,851		probably benign	Het
Alms1	A	G	6: 85,702,600	T3240A	probably damaging	Het
Ap3d1	A	G	10: 80,719,241	W417R	probably damaging	Het
Arfgef1	C	A	1: 10,179,987		probably benign	Het
Cacna1s	T	A	1: 136,089,008		probably benign	Het
Clcn1	T	C	6: 42,310,581	F740L	probably benign	Het
Clec12a	T	A	6: 129,364,053	D265E	probably benign	Het
Clic3	T	A	2: 25,457,785		probably benign	Het
Cntnap3	T	G	13: 64,762,045	T749P	probably benign	Het
Col11a2	T	A	17: 34,042,212	D45E	probably null	Het
Crxos	T	A	7: 15,898,535	S89T	probably benign	Het
Cxcr1	G	T	1: 74,192,309	P185T	possibly damaging	Het
Cyp20a1	T	A	1: 60,371,327	N262K	possibly damaging	Het
Dpy19l2	T	C	9: 24,696,028	R46G	probably benign	Het
Dpysl2	A	T	14: 66,807,962	L454Q	probably damaging	Het
Dvl3	C	T	16: 20,527,423		probably benign	Het
Eppin	T	A	2: 164,589,412	E98V	possibly damaging	Het
Fancm	A	T	12: 65,106,061	H1097L	probably benign	Het
Fkbp4	A	G	6: 128,435,742	I75T	probably damaging	Het
Fmn2	A	G	1: 174,581,959	H586R	unknown	Het
Gm973	C	T	1: 59,558,234		probably benign	Het
Haus6	A	C	4: 86,602,846	V185G	possibly damaging	Het
Herc2	T	A	7: 56,122,366	C1098S	possibly damaging	Het
Hic1	C	A	11: 75,166,310	L584F	possibly damaging	Het
Itgb1bp1	C	A	12: 21,276,895		probably benign	Het
Kbtbd2	G	A	6: 56,780,389	R121*	probably null	Het
Lgr4	C	T	2: 110,007,281		probably benign	Het
Lrrc55	T	C	2: 85,191,920	E309G	probably damaging	Het
Mertk	T	C	2: 128,793,107		probably null	Het
Micu3	A	G	8: 40,366,253		probably benign	Het
Mmp11	G	A	10: 75,926,758	A287V	probably benign	Het
Mpzl2	A	G	9: 45,042,741	Y47C	probably damaging	Het
Muc5b	A	C	7: 141,862,015	R2899S	probably benign	Het
Myo1b	A	G	1: 51,755,698	Y1078H	probably benign	Het
Naip1	A	T	13: 100,423,219	D1092E	probably benign	Het
Ncapd3	T	G	9: 27,057,883	V611G	probably damaging	Het
Ntpcr	C	T	8: 125,737,354	R73*	probably null	Het
Olfr1225	A	T	2: 89,170,360	V284E	probably benign	Het
Olfr1475	G	A	19: 13,479,493	A235V	probably damaging	Het
Osbp2	A	G	11: 3,714,709	F88S	probably damaging	Het
Pkn3	A	T	2: 30,089,877	T711S	probably damaging	Het
Plekhm1	T	C	11: 103,394,776	K278E	probably benign	Het
Ppp1r36	A	G	12: 76,439,291	T408A	probably benign	Het
Prss41	T	C	17: 23,842,503	T105A	possibly damaging	Het
Psme1	G	T	14: 55,579,921		probably benign	Het
Ptprq	A	T	10: 107,608,175	Y1523N	probably damaging	Het
Ric8b	A	G	10: 84,992,222	D470G	probably damaging	Het
Scarb1	A	G	5: 125,298,731		probably benign	Het
Slc25a54	G	A	3: 109,102,796	A204T	probably damaging	Het
Spink10	T	C	18: 62,659,965	C67R	probably damaging	Het
St5	T	A	7: 109,557,204	Q113L	probably benign	Het
Tmtc1	A	T	6: 148,412,640		probably null	Het
Tprkb	A	G	6: 85,924,464	D28G	probably benign	Het
Ttll13	A	G	7: 80,260,350	H747R	probably benign	Het
Usp24	A	G	4: 106,402,105	S1608G	probably benign	Het
Utp20	A	T	10: 88,760,912	F2115L	probably damaging	Het
Vmn1r200	A	T	13: 22,395,191	I46L	probably benign	Het
Zdhhc8	A	T	16: 18,228,390	M103K	probably damaging	Het
Zfp595	C	T	13: 67,317,305	G298E	probably damaging	Het
Zfp738	T	G	13: 67,670,021	H617P	possibly damaging	Het
Zfp9	A	T	6: 118,465,202	H166Q	probably damaging	Het
Zp3r	C	A	1: 130,618,334	D80Y	probably damaging	Het

Other mutations in Atf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Atf6	APN	1	170788606	critical splice donor site	probably null
IGL01431:Atf6	APN	1	170853002	splice site	probably benign
IGL01755:Atf6	APN	1	170788611	missense	possibly damaging	0.63
IGL02060:Atf6	APN	1	170819420	missense	probably damaging	0.99
IGL02416:Atf6	APN	1	170747157	nonsense	probably null
IGL02903:Atf6	APN	1	170799714	missense	probably benign	0.00
IGL02989:Atf6	APN	1	170788683	splice site	probably benign
IGL03209:Atf6	APN	1	170834894	missense	probably benign
R0455:Atf6	UTSW	1	170834923	missense	probably benign	0.00
R0467:Atf6	UTSW	1	170794020	missense	probably damaging	1.00
R0784:Atf6	UTSW	1	170709947	missense	probably benign	0.19
R1486:Atf6	UTSW	1	170794691	missense	probably damaging	1.00
R1850:Atf6	UTSW	1	170819286	missense	probably damaging	1.00
R1945:Atf6	UTSW	1	170855141	missense	probably benign	0.00
R2164:Atf6	UTSW	1	170794735	missense	probably damaging	1.00
R3782:Atf6	UTSW	1	170794767	nonsense	probably null
R4454:Atf6	UTSW	1	170794039	missense	probably damaging	0.99
R4631:Atf6	UTSW	1	170747197	splice site	probably null
R4676:Atf6	UTSW	1	170787410	missense	probably damaging	1.00
R5772:Atf6	UTSW	1	170747189	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841775	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841776	missense	possibly damaging	0.95
R5950:Atf6	UTSW	1	170834879	missense	probably damaging	1.00
R6242:Atf6	UTSW	1	170793976	missense	possibly damaging	0.46
R6520:Atf6	UTSW	1	170867669	missense	probably benign	0.00
R7032:Atf6	UTSW	1	170799612	critical splice donor site	probably null
R7472:Atf6	UTSW	1	170815491	missense	possibly damaging	0.83
R7923:Atf6	UTSW	1	170794706	missense	probably benign
R8002:Atf6	UTSW	1	170819254	missense	probably benign	0.43
R8860:Atf6	UTSW	1	170852966	missense	probably null	0.95
R8956:Atf6	UTSW	1	170794007	missense	probably damaging	0.98
R9090:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9271:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9323:Atf6	UTSW	1	170855113	nonsense	probably null
R9500:Atf6	UTSW	1	170747139	missense	probably damaging	0.98
R9594:Atf6	UTSW	1	170840833	missense	probably benign	0.18
R9733:Atf6	UTSW	1	170834833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTCAGATGCGGTCTATGTTCTCACC -3'
(R):5'- TTCAGATGTGGCCTTAGAATGGCAG -3'

Sequencing Primer
(F):5'- GTCTATGTTCTCACCGCACAG -3'
(R):5'- TGGCCTTAGAATGGCAGGAATAG -3'

Posted On

2013-05-23