Mutagenetix > Incidental Mutations

Incidental Mutation 'R5288:Cftr'

424475

Institutional Source

Beutler Lab

Gene Symbol

Cftr

Ensembl Gene

ENSMUSG00000041301

Gene Name

cystic fibrosis transmembrane conductance regulator

Synonyms

Abcc7

MMRRC Submission

042842-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R5288 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18170687-18322768 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 18226129 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 359 (Q359*)

Ref Sequence

ENSEMBL: ENSMUSP00000116957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000129452] [ENSMUST00000140407]

AlphaFold

P26361

Predicted Effect

probably null
Transcript: ENSMUST00000045706
AA Change: Q359*

SMART Domains

Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: Q359*

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	3.7e-40	PFAM
AAA	450	623	2.16e-12	SMART
Pfam:CFTR_R	639	844	2e-93	PFAM
Pfam:ABC_membrane	857	1142	2.7e-53	PFAM
AAA	1232	1414	9.94e-12	SMART
low complexity region	1465	1474	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115405
AA Change: Q359*

SMART Domains

Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301
AA Change: Q359*

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.4e-48	PFAM
Pfam:ABC_tran	441	570	2.3e-19	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000115406
AA Change: Q329*

SMART Domains

Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: Q329*

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	167	4e-14	PFAM
Pfam:ABC_membrane	162	320	2.5e-20	PFAM
AAA	420	593	2.16e-12	SMART
Pfam:CFTR_R	609	815	1.3e-97	PFAM
Pfam:ABC_membrane	827	1112	1e-50	PFAM
AAA	1202	1384	9.94e-12	SMART
low complexity region	1435	1444	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000129452
AA Change: Q359*

SMART Domains

Protein: ENSMUSP00000115334
Gene: ENSMUSG00000041301
AA Change: Q359*

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	3.9e-39	PFAM
Pfam:ABC_tran	441	528	5.6e-11	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000140407
AA Change: Q359*

SMART Domains

Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301
AA Change: Q359*

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.2e-48	PFAM
Pfam:ABC_tran	441	568	6.3e-20	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110001I22Rik	T	G	16: 13,677,758	N240K	probably benign	Het
Abcc12	A	T	8: 86,566,539	Y7N	probably damaging	Het
Adcy1	A	C	11: 7,161,351	I881L	probably benign	Het
Aftph	T	C	11: 20,726,994	D205G	probably damaging	Het
Aldh7a1	T	A	18: 56,534,253	N316Y	possibly damaging	Het
Ankrd36	A	G	11: 5,689,340		probably benign	Het
C87414	C	T	5: 93,637,748	M224I	possibly damaging	Het
Ccdc88a	T	G	11: 29,498,416	N1465K	possibly damaging	Het
Ccpg1	G	A	9: 73,013,044	S647N	probably benign	Het
Cep70	T	A	9: 99,281,075	L325Q	probably damaging	Het
Cfap46	A	G	7: 139,613,507		probably null	Het
Chrne	A	T	11: 70,615,087	N457K	possibly damaging	Het
Cntn2	A	G	1: 132,523,677	I438T	probably benign	Het
Cntn4	T	C	6: 106,181,804	L10P	possibly damaging	Het
Copg1	G	T	6: 87,890,207	M87I	possibly damaging	Het
Cyfip1	A	T	7: 55,925,135	M1045L	possibly damaging	Het
Cyp2c29	C	T	19: 39,330,372	P432L	probably damaging	Het
Dcaf11	T	A	14: 55,563,376	D96E	probably damaging	Het
Dmxl2	A	G	9: 54,378,757	S2715P	probably benign	Het
Dnhd1	G	A	7: 105,714,437	E4069K	possibly damaging	Het
Dpy19l4	T	A	4: 11,289,721	N330I	probably damaging	Het
Dpy19l4	G	T	4: 11,304,014	A132D	probably damaging	Het
Duox2	A	G	2: 122,295,136	V330A	probably benign	Het
Dusp11	T	C	6: 85,947,605	*322W	probably null	Het
Dusp8	T	A	7: 142,089,993	Q61L	possibly damaging	Het
Eml3	G	A	19: 8,939,274	G720S	probably damaging	Het
F11	A	G	8: 45,246,796	S418P	probably damaging	Het
Fam91a1	G	A	15: 58,448,394	S645N	probably benign	Het
Fat2	G	A	11: 55,267,656	T3412I	probably benign	Het
Fbxo38	A	G	18: 62,540,971	M13T	probably benign	Het
Fbxo48	G	T	11: 16,954,329	L160F	possibly damaging	Het
Gm10134	T	A	2: 28,506,360		probably benign	Het
Gm11787	T	C	4: 3,511,795		noncoding transcript	Het
Gm14085	C	A	2: 122,522,778	L480I	probably benign	Het
Gpatch8	A	T	11: 102,508,227		probably null	Het
Gucy2g	G	A	19: 55,215,116	A750V	probably damaging	Het
Hephl1	T	C	9: 15,076,854	T653A	possibly damaging	Het
Herc3	T	A	6: 58,874,278	M504K	probably damaging	Het
Hmcn2	A	G	2: 31,460,321	T5077A	probably benign	Het
Ifitm3	T	C	7: 141,010,641	N2S	probably benign	Het
Ighe	T	C	12: 113,271,472	H356R	probably benign	Het
Ighv10-3	T	A	12: 114,523,505	M99L	probably benign	Het
Izumo4	C	A	10: 80,702,805	C30*	probably null	Het
Jag1	A	T	2: 137,095,544	H303Q	possibly damaging	Het
Kif24	T	C	4: 41,395,373	E500G	probably benign	Het
Kng1	A	T	16: 23,079,092	D414V	probably damaging	Het
Loxhd1	A	C	18: 77,363,612	D410A	probably damaging	Het
Ltn1	T	C	16: 87,416,011	K554R	possibly damaging	Het
Ly75	A	G	2: 60,303,641	C1547R	probably damaging	Het
Ms4a6d	A	T	19: 11,587,136	S124T	possibly damaging	Het
Mtfr2	A	G	10: 20,357,702	D339G	probably damaging	Het
Myh10	T	A	11: 68,801,608	L1369Q	probably damaging	Het
Myh11	A	T	16: 14,208,008	V1366D	possibly damaging	Het
Nadsyn1	A	G	7: 143,803,286	V491A	possibly damaging	Het
Nav3	T	C	10: 109,853,105	N437S	probably benign	Het
Ncf1	A	G	5: 134,221,805	L373P	probably damaging	Het
Neb	A	T	2: 52,189,861	I85N	probably damaging	Het
Nktr	A	G	9: 121,748,593	K576E	probably benign	Het
Nmur2	T	A	11: 56,040,214	I224F	probably damaging	Het
Oas3	A	G	5: 120,756,990	F978S	probably damaging	Het
Olfr1115	C	T	2: 87,252,483	P182L	probably benign	Het
Olfr1331	T	C	4: 118,869,575	S264P	probably damaging	Het
Olfr330	A	T	11: 58,529,482	M168K	probably damaging	Het
Olfr457	T	A	6: 42,471,252	I309F	probably benign	Het
Olfr484	T	C	7: 108,125,168	T32A	probably benign	Het
Pcyox1	A	T	6: 86,392,354		probably null	Het
Pdcd7	G	A	9: 65,358,692	W477*	probably null	Het
Pitpnm1	T	C	19: 4,103,435	F197S	probably damaging	Het
Plce1	C	A	19: 38,760,091	N1755K	probably damaging	Het
Pnpla7	C	A	2: 25,041,019	P882Q	probably damaging	Het
Pold2	A	G	11: 5,876,760	L58P	probably damaging	Het
Pomt1	C	G	2: 32,244,299	Y277*	probably null	Het
Pou4f2	A	G	8: 78,436,329	Y26H	unknown	Het
Ppm1e	A	T	11: 87,358,551	L118Q	possibly damaging	Het
Prdx2	T	A	8: 84,971,673	Y164*	probably null	Het
Prkra	T	G	2: 76,639,278	T146P	probably damaging	Het
Prpf8	A	G	11: 75,495,799	D1038G	probably damaging	Het
Rab4a	A	T	8: 123,827,374	I16L	probably benign	Het
Rai2	A	G	X: 161,778,640	N363S	probably benign	Het
Ranbp17	A	T	11: 33,219,241	V991D	possibly damaging	Het
Rimbp2	G	A	5: 128,788,592	T557M	probably benign	Het
Rmi1	G	A	13: 58,409,466	G510R	probably damaging	Het
Sdad1	A	G	5: 92,286,825	*687Q	probably null	Het
Sema6d	T	C	2: 124,664,246	L720P	probably damaging	Het
Setx	T	G	2: 29,134,033		probably null	Het
Sgsm3	T	C	15: 81,007,999	V256A	probably benign	Het
Soga3	A	G	10: 29,196,770	D686G	probably benign	Het
Sppl2c	T	A	11: 104,187,301	I309K	possibly damaging	Het
Stard9	A	G	2: 120,700,630	E2456G	probably damaging	Het
Strn3	C	G	12: 51,648,020	R320P	probably damaging	Het
Supv3l1	A	T	10: 62,430,596	N600K	possibly damaging	Het
Syne2	T	A	12: 76,099,338	S6377T	possibly damaging	Het
Tas2r123	A	T	6: 132,847,227	H29L	probably benign	Het
Tbl3	C	T	17: 24,705,970	V52M	possibly damaging	Het
Tbp	A	G	17: 15,507,347	I145V	probably benign	Het
Tcf20	A	T	15: 82,855,709	S514T	possibly damaging	Het
Tgm4	A	G	9: 123,056,494	Y367C	probably damaging	Het
Tle1	C	T	4: 72,141,844	V258M	probably damaging	Het
Tln1	C	T	4: 43,540,661	V1447I	probably benign	Het
Tnfrsf11b	C	T	15: 54,278,226	A8T	probably benign	Het
Trim80	A	T	11: 115,448,017	T558S	probably benign	Het
Trmt6	C	A	2: 132,808,783	A302S	probably benign	Het
Tsen15	C	T	1: 152,383,380	V76I	probably damaging	Het
Ttc17	A	T	2: 94,303,640	W1067R	probably damaging	Het
Ucn3	A	T	13: 3,941,474	F59L	probably benign	Het
Ulk3	T	A	9: 57,590,740	I108N	possibly damaging	Het
Vmn2r94	A	C	17: 18,244,466	Y521D	probably damaging	Het
Vps45	T	C	3: 96,057,774	M1V	probably null	Het
Vta1	C	A	10: 14,705,399	L21F	probably damaging	Het
Zdhhc21	C	T	4: 82,847,692	G2D	probably damaging	Het
Zfp169	A	T	13: 48,490,275	C459S	possibly damaging	Het
Zfp90	C	T	8: 106,425,368	T571M	probably damaging	Het
Zswim8	A	T	14: 20,718,871	N1119I	possibly damaging	Het

Other mutations in Cftr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00901:Cftr	APN	6	18268430	critical splice donor site	probably null
IGL01082:Cftr	APN	6	18226103	missense	probably damaging	0.97
IGL01113:Cftr	APN	6	18270253	missense	probably damaging	1.00
IGL01383:Cftr	APN	6	18226041	missense	probably benign	0.00
IGL01595:Cftr	APN	6	18198239	splice site	probably benign
IGL01820:Cftr	APN	6	18226139	missense	probably damaging	1.00
IGL02223:Cftr	APN	6	18221482	missense	probably damaging	1.00
IGL02249:Cftr	APN	6	18277871	missense	possibly damaging	0.58
IGL02439:Cftr	APN	6	18258238	nonsense	probably null
IGL02537:Cftr	APN	6	18274597	missense	probably benign	0.31
IGL03234:Cftr	APN	6	18225988	missense	probably damaging	0.96
BB004:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
BB014:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
PIT4453001:Cftr	UTSW	6	18214106	missense	probably damaging	0.99
PIT4520001:Cftr	UTSW	6	18277843	missense	probably benign	0.01
R0114:Cftr	UTSW	6	18282448	missense	probably damaging	1.00
R0329:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0330:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0331:Cftr	UTSW	6	18235226	missense	possibly damaging	0.72
R0480:Cftr	UTSW	6	18274518	splice site	probably benign
R0612:Cftr	UTSW	6	18198126	missense	probably benign	0.01
R0633:Cftr	UTSW	6	18305980	missense	probably damaging	0.99
R0830:Cftr	UTSW	6	18270225	missense	probably benign	0.02
R1559:Cftr	UTSW	6	18225937	missense	probably benign	0.01
R1629:Cftr	UTSW	6	18226106	missense	probably damaging	1.00
R1636:Cftr	UTSW	6	18226157	missense	probably damaging	0.99
R1860:Cftr	UTSW	6	18268289	missense	probably benign	0.00
R2043:Cftr	UTSW	6	18320935	missense	probably benign
R2211:Cftr	UTSW	6	18214280	missense	probably null	0.13
R4737:Cftr	UTSW	6	18299883	missense	probably benign	0.19
R4793:Cftr	UTSW	6	18226088	missense	probably damaging	1.00
R4857:Cftr	UTSW	6	18320975	missense	possibly damaging	0.92
R4984:Cftr	UTSW	6	18235199	missense	possibly damaging	0.89
R4999:Cftr	UTSW	6	18221614	missense	probably benign	0.17
R5045:Cftr	UTSW	6	18230081	missense	probably benign	0.20
R5183:Cftr	UTSW	6	18299833	missense	probably damaging	0.99
R5197:Cftr	UTSW	6	18255414	missense	probably benign	0.00
R5337:Cftr	UTSW	6	18319059	missense	probably damaging	1.00
R5549:Cftr	UTSW	6	18227954	missense	probably benign	0.00
R5596:Cftr	UTSW	6	18268096	missense	probably benign	0.00
R5651:Cftr	UTSW	6	18255365	splice site	probably null
R5660:Cftr	UTSW	6	18313687	missense	probably benign	0.22
R5941:Cftr	UTSW	6	18313646	missense	probably damaging	1.00
R6221:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6222:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6229:Cftr	UTSW	6	18220684	missense	probably damaging	1.00
R6256:Cftr	UTSW	6	18274661	missense	probably damaging	0.96
R6257:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6412:Cftr	UTSW	6	18285604	missense	probably damaging	0.97
R6459:Cftr	UTSW	6	18258236	missense	probably damaging	1.00
R6558:Cftr	UTSW	6	18222528	missense	probably damaging	1.00
R6724:Cftr	UTSW	6	18255974	nonsense	probably null
R6787:Cftr	UTSW	6	18274608	nonsense	probably null
R6861:Cftr	UTSW	6	18268108	missense	probably benign	0.00
R6888:Cftr	UTSW	6	18313730	critical splice donor site	probably null
R7084:Cftr	UTSW	6	18226138	missense	probably benign	0.17
R7105:Cftr	UTSW	6	18318972	missense	probably damaging	1.00
R7320:Cftr	UTSW	6	18319013	missense	probably damaging	0.97
R7359:Cftr	UTSW	6	18221624	missense	probably benign	0.00
R7466:Cftr	UTSW	6	18227973	missense	probably benign
R7502:Cftr	UTSW	6	18214296	missense	probably damaging	1.00
R7748:Cftr	UTSW	6	18277889	critical splice donor site	probably null
R7808:Cftr	UTSW	6	18204205	missense	probably benign
R7817:Cftr	UTSW	6	18267968	missense	probably damaging	0.97
R7927:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
R7968:Cftr	UTSW	6	18226049	missense	probably benign	0.00
R7995:Cftr	UTSW	6	18214156	missense	probably damaging	1.00
R8171:Cftr	UTSW	6	18258288	missense	probably damaging	1.00
R8210:Cftr	UTSW	6	18220697	missense	probably damaging	1.00
R8548:Cftr	UTSW	6	18273699	missense	possibly damaging	0.87
R8712:Cftr	UTSW	6	18274697	missense	probably damaging	0.99
R8737:Cftr	UTSW	6	18319729	missense	probably damaging	1.00
R8926:Cftr	UTSW	6	18268004	missense	possibly damaging	0.83
R8979:Cftr	UTSW	6	18227948	missense	probably benign	0.10
R8996:Cftr	UTSW	6	18255946	nonsense	probably null
R9087:Cftr	UTSW	6	18214181	missense	possibly damaging	0.91
R9115:Cftr	UTSW	6	18235311	missense	probably damaging	1.00
R9406:Cftr	UTSW	6	18299867	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTGGAGCTGAAAATGACCCG -3'
(R):5'- ATTTTCACTGTAAGCGCTCATG -3'

Sequencing Primer
(F):5'- CGGAAGGCGGCCTATATG -3'
(R):5'- CACTGTAAGCGCTCATGAAATTATG -3'

Posted On

2016-08-04