Mutagenetix > Incidental Mutation

Incidental Mutation 'R5288:Dnhd1'

424485

Institutional Source

Beutler Lab

Gene Symbol

Dnhd1

Ensembl Gene

ENSMUSG00000030882

Gene Name

dynein heavy chain domain 1

Synonyms

8030491N06Rik

MMRRC Submission

042842-MU

Accession Numbers

Variant 1:ENSMUST00000145988; OTTMUST00000062891; Variant 2: ENSMUST00000106773; Variant 3: ENSMUST00000106776; Variant 4: ENSMUST00000163171; Variant 5: ENSMUST00000142363;OTTMUST00000062869; Variant 6: ENSMUST00000142874; OTTMUST00000062870; Variant 7: ENSMUST00000128388; OTTMUST00000062892; MGI:1924755

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R5288 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105650827-105721799 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 105714437 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 4069 (E4069K)

Ref Sequence

ENSEMBL: ENSMUSP00000121261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000145988]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145988
AA Change: E4069K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: E4069K

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC
low complexity region	183	191	N/A	INTRINSIC
low complexity region	253	269	N/A	INTRINSIC
low complexity region	943	962	N/A	INTRINSIC
Pfam:DHC_N2	1018	1472	4.6e-50	PFAM
Pfam:AAA_6	1652	1875	2.7e-14	PFAM
low complexity region	1906	1918	N/A	INTRINSIC
Blast:AAA	1993	2196	1e-34	BLAST
Pfam:AAA_7	2362	2610	3.3e-11	PFAM
low complexity region	2697	2714	N/A	INTRINSIC
low complexity region	2722	2733	N/A	INTRINSIC
low complexity region	2800	2810	N/A	INTRINSIC
low complexity region	3116	3134	N/A	INTRINSIC
Pfam:MT	3178	3470	3.9e-16	PFAM
coiled coil region	3590	3642	N/A	INTRINSIC
coiled coil region	3816	3843	N/A	INTRINSIC
Pfam:Dynein_heavy	3976	4746	7.3e-97	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110001I22Rik	T	G	16: 13,677,758	N240K	probably benign	Het
Abcc12	A	T	8: 86,566,539	Y7N	probably damaging	Het
Adcy1	A	C	11: 7,161,351	I881L	probably benign	Het
Aftph	T	C	11: 20,726,994	D205G	probably damaging	Het
Aldh7a1	T	A	18: 56,534,253	N316Y	possibly damaging	Het
Ankrd36	A	G	11: 5,689,340		probably benign	Het
C87414	C	T	5: 93,637,748	M224I	possibly damaging	Het
Ccdc88a	T	G	11: 29,498,416	N1465K	possibly damaging	Het
Ccpg1	G	A	9: 73,013,044	S647N	probably benign	Het
Cep70	T	A	9: 99,281,075	L325Q	probably damaging	Het
Cfap46	A	G	7: 139,613,507		probably null	Het
Cftr	C	T	6: 18,226,129	Q359*	probably null	Het
Chrne	A	T	11: 70,615,087	N457K	possibly damaging	Het
Cntn2	A	G	1: 132,523,677	I438T	probably benign	Het
Cntn4	T	C	6: 106,181,804	L10P	possibly damaging	Het
Copg1	G	T	6: 87,890,207	M87I	possibly damaging	Het
Cyfip1	A	T	7: 55,925,135	M1045L	possibly damaging	Het
Cyp2c29	C	T	19: 39,330,372	P432L	probably damaging	Het
Dcaf11	T	A	14: 55,563,376	D96E	probably damaging	Het
Dmxl2	A	G	9: 54,378,757	S2715P	probably benign	Het
Dpy19l4	T	A	4: 11,289,721	N330I	probably damaging	Het
Dpy19l4	G	T	4: 11,304,014	A132D	probably damaging	Het
Duox2	A	G	2: 122,295,136	V330A	probably benign	Het
Dusp11	T	C	6: 85,947,605	*322W	probably null	Het
Dusp8	T	A	7: 142,089,993	Q61L	possibly damaging	Het
Eml3	G	A	19: 8,939,274	G720S	probably damaging	Het
F11	A	G	8: 45,246,796	S418P	probably damaging	Het
Fam91a1	G	A	15: 58,448,394	S645N	probably benign	Het
Fat2	G	A	11: 55,267,656	T3412I	probably benign	Het
Fbxo38	A	G	18: 62,540,971	M13T	probably benign	Het
Fbxo48	G	T	11: 16,954,329	L160F	possibly damaging	Het
Gm10134	T	A	2: 28,506,360		probably benign	Het
Gm11787	T	C	4: 3,511,795		noncoding transcript	Het
Gm14085	C	A	2: 122,522,778	L480I	probably benign	Het
Gpatch8	A	T	11: 102,508,227		probably null	Het
Gucy2g	G	A	19: 55,215,116	A750V	probably damaging	Het
Hephl1	T	C	9: 15,076,854	T653A	possibly damaging	Het
Herc3	T	A	6: 58,874,278	M504K	probably damaging	Het
Hmcn2	A	G	2: 31,460,321	T5077A	probably benign	Het
Ifitm3	T	C	7: 141,010,641	N2S	probably benign	Het
Ighe	T	C	12: 113,271,472	H356R	probably benign	Het
Ighv10-3	T	A	12: 114,523,505	M99L	probably benign	Het
Izumo4	C	A	10: 80,702,805	C30*	probably null	Het
Jag1	A	T	2: 137,095,544	H303Q	possibly damaging	Het
Kif24	T	C	4: 41,395,373	E500G	probably benign	Het
Kng1	A	T	16: 23,079,092	D414V	probably damaging	Het
Loxhd1	A	C	18: 77,363,612	D410A	probably damaging	Het
Ltn1	T	C	16: 87,416,011	K554R	possibly damaging	Het
Ly75	A	G	2: 60,303,641	C1547R	probably damaging	Het
Ms4a6d	A	T	19: 11,587,136	S124T	possibly damaging	Het
Mtfr2	A	G	10: 20,357,702	D339G	probably damaging	Het
Myh10	T	A	11: 68,801,608	L1369Q	probably damaging	Het
Myh11	A	T	16: 14,208,008	V1366D	possibly damaging	Het
Nadsyn1	A	G	7: 143,803,286	V491A	possibly damaging	Het
Nav3	T	C	10: 109,853,105	N437S	probably benign	Het
Ncf1	A	G	5: 134,221,805	L373P	probably damaging	Het
Neb	A	T	2: 52,189,861	I85N	probably damaging	Het
Nktr	A	G	9: 121,748,593	K576E	probably benign	Het
Nmur2	T	A	11: 56,040,214	I224F	probably damaging	Het
Oas3	A	G	5: 120,756,990	F978S	probably damaging	Het
Olfr1115	C	T	2: 87,252,483	P182L	probably benign	Het
Olfr1331	T	C	4: 118,869,575	S264P	probably damaging	Het
Olfr330	A	T	11: 58,529,482	M168K	probably damaging	Het
Olfr457	T	A	6: 42,471,252	I309F	probably benign	Het
Olfr484	T	C	7: 108,125,168	T32A	probably benign	Het
Pcyox1	A	T	6: 86,392,354		probably null	Het
Pdcd7	G	A	9: 65,358,692	W477*	probably null	Het
Pitpnm1	T	C	19: 4,103,435	F197S	probably damaging	Het
Plce1	C	A	19: 38,760,091	N1755K	probably damaging	Het
Pnpla7	C	A	2: 25,041,019	P882Q	probably damaging	Het
Pold2	A	G	11: 5,876,760	L58P	probably damaging	Het
Pomt1	C	G	2: 32,244,299	Y277*	probably null	Het
Pou4f2	A	G	8: 78,436,329	Y26H	unknown	Het
Ppm1e	A	T	11: 87,358,551	L118Q	possibly damaging	Het
Prdx2	T	A	8: 84,971,673	Y164*	probably null	Het
Prkra	T	G	2: 76,639,278	T146P	probably damaging	Het
Prpf8	A	G	11: 75,495,799	D1038G	probably damaging	Het
Rab4a	A	T	8: 123,827,374	I16L	probably benign	Het
Rai2	A	G	X: 161,778,640	N363S	probably benign	Het
Ranbp17	A	T	11: 33,219,241	V991D	possibly damaging	Het
Rimbp2	G	A	5: 128,788,592	T557M	probably benign	Het
Rmi1	G	A	13: 58,409,466	G510R	probably damaging	Het
Sdad1	A	G	5: 92,286,825	*687Q	probably null	Het
Sema6d	T	C	2: 124,664,246	L720P	probably damaging	Het
Setx	T	G	2: 29,134,033		probably null	Het
Sgsm3	T	C	15: 81,007,999	V256A	probably benign	Het
Soga3	A	G	10: 29,196,770	D686G	probably benign	Het
Sppl2c	T	A	11: 104,187,301	I309K	possibly damaging	Het
Stard9	A	G	2: 120,700,630	E2456G	probably damaging	Het
Strn3	C	G	12: 51,648,020	R320P	probably damaging	Het
Supv3l1	A	T	10: 62,430,596	N600K	possibly damaging	Het
Syne2	T	A	12: 76,099,338	S6377T	possibly damaging	Het
Tas2r123	A	T	6: 132,847,227	H29L	probably benign	Het
Tbl3	C	T	17: 24,705,970	V52M	possibly damaging	Het
Tbp	A	G	17: 15,507,347	I145V	probably benign	Het
Tcf20	A	T	15: 82,855,709	S514T	possibly damaging	Het
Tgm4	A	G	9: 123,056,494	Y367C	probably damaging	Het
Tle1	C	T	4: 72,141,844	V258M	probably damaging	Het
Tln1	C	T	4: 43,540,661	V1447I	probably benign	Het
Tnfrsf11b	C	T	15: 54,278,226	A8T	probably benign	Het
Trim80	A	T	11: 115,448,017	T558S	probably benign	Het
Trmt6	C	A	2: 132,808,783	A302S	probably benign	Het
Tsen15	C	T	1: 152,383,380	V76I	probably damaging	Het
Ttc17	A	T	2: 94,303,640	W1067R	probably damaging	Het
Ucn3	A	T	13: 3,941,474	F59L	probably benign	Het
Ulk3	T	A	9: 57,590,740	I108N	possibly damaging	Het
Vmn2r94	A	C	17: 18,244,466	Y521D	probably damaging	Het
Vps45	T	C	3: 96,057,774	M1V	probably null	Het
Vta1	C	A	10: 14,705,399	L21F	probably damaging	Het
Zdhhc21	C	T	4: 82,847,692	G2D	probably damaging	Het
Zfp169	A	T	13: 48,490,275	C459S	possibly damaging	Het
Zfp90	C	T	8: 106,425,368	T571M	probably damaging	Het
Zswim8	A	T	14: 20,718,871	N1119I	possibly damaging	Het

Other mutations in Dnhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Dnhd1	APN	7	105677995	missense	probably damaging	1.00
IGL00516:Dnhd1	APN	7	105657211	missense	possibly damaging	0.52
IGL00576:Dnhd1	APN	7	105692675	missense	probably damaging	1.00
IGL00990:Dnhd1	APN	7	105721688	missense	possibly damaging	0.85
IGL01346:Dnhd1	APN	7	105713909	missense	probably benign
IGL01714:Dnhd1	APN	7	105720942	missense	probably damaging	1.00
IGL01735:Dnhd1	APN	7	105713754	missense	probably benign	0.37
IGL01814:Dnhd1	APN	7	105652030	missense	probably benign
IGL01999:Dnhd1	APN	7	105721215	missense	possibly damaging	0.50
IGL02022:Dnhd1	APN	7	105678309	missense	probably damaging	1.00
IGL02131:Dnhd1	APN	7	105720802	missense	probably damaging	1.00
IGL02156:Dnhd1	APN	7	105721744	missense	probably damaging	1.00
IGL02674:Dnhd1	APN	7	105721481	missense	probably benign	0.00
IGL02966:Dnhd1	APN	7	105720741	missense	probably benign	0.00
IGL03066:Dnhd1	APN	7	105719882	missense	probably damaging	0.99
IGL03298:Dnhd1	APN	7	105714475	missense	probably damaging	0.98
IGL03378:Dnhd1	APN	7	105713733	missense	possibly damaging	0.87
IGL02802:Dnhd1	UTSW	7	105655723	missense	possibly damaging	0.83
R0060:Dnhd1	UTSW	7	105668514	missense	probably damaging	0.99
R0129:Dnhd1	UTSW	7	105720924	missense	probably benign	0.19
R0238:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0238:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0239:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0239:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0384:Dnhd1	UTSW	7	105720114	missense	possibly damaging	0.56
R0453:Dnhd1	UTSW	7	105674444	missense	probably benign	0.00
R0540:Dnhd1	UTSW	7	105720788	missense	probably benign	0.04
R0554:Dnhd1	UTSW	7	105694395	missense	probably benign	0.10
R0576:Dnhd1	UTSW	7	105714045	missense	probably damaging	1.00
R0607:Dnhd1	UTSW	7	105720788	missense	probably benign	0.04
R0631:Dnhd1	UTSW	7	105651624	missense	probably benign	0.17
R0639:Dnhd1	UTSW	7	105696464	missense	possibly damaging	0.95
R0668:Dnhd1	UTSW	7	105695751	missense	probably benign
R0669:Dnhd1	UTSW	7	105693704	missense	probably benign	0.01
R0670:Dnhd1	UTSW	7	105696464	missense	possibly damaging	0.95
R0699:Dnhd1	UTSW	7	105651906	missense	probably damaging	0.98
R1019:Dnhd1	UTSW	7	105709171	missense	probably damaging	1.00
R1144:Dnhd1	UTSW	7	105713031	missense	probably damaging	1.00
R1226:Dnhd1	UTSW	7	105696899	missense	probably damaging	1.00
R1257:Dnhd1	UTSW	7	105694153	missense	probably damaging	1.00
R1391:Dnhd1	UTSW	7	105720124	missense	probably damaging	1.00
R1453:Dnhd1	UTSW	7	105721273	critical splice donor site	probably null
R1501:Dnhd1	UTSW	7	105668463	missense	probably benign	0.00
R1503:Dnhd1	UTSW	7	105693660	missense	possibly damaging	0.67
R1515:Dnhd1	UTSW	7	105704148	missense	probably benign	0.11
R1615:Dnhd1	UTSW	7	105703206	missense	probably benign	0.00
R1615:Dnhd1	UTSW	7	105713706	missense	possibly damaging	0.74
R1656:Dnhd1	UTSW	7	105714281	missense	probably damaging	1.00
R1720:Dnhd1	UTSW	7	105693828	missense	probably benign
R1723:Dnhd1	UTSW	7	105714920	missense	possibly damaging	0.60
R1766:Dnhd1	UTSW	7	105693972	missense	possibly damaging	0.50
R1799:Dnhd1	UTSW	7	105655767	missense	probably benign	0.31
R1860:Dnhd1	UTSW	7	105704205	missense	probably benign
R1920:Dnhd1	UTSW	7	105713407	missense	probably benign	0.00
R1925:Dnhd1	UTSW	7	105652252	missense	probably damaging	1.00
R1925:Dnhd1	UTSW	7	105673854	missense	probably damaging	0.96
R1934:Dnhd1	UTSW	7	105708582	missense	probably benign	0.05
R1935:Dnhd1	UTSW	7	105673976	missense	probably benign	0.09
R1936:Dnhd1	UTSW	7	105673976	missense	probably benign	0.09
R2035:Dnhd1	UTSW	7	105704921	missense	probably damaging	0.99
R2125:Dnhd1	UTSW	7	105677971	missense	probably benign	0.35
R2127:Dnhd1	UTSW	7	105693721	missense	possibly damaging	0.56
R2254:Dnhd1	UTSW	7	105703772	missense	probably damaging	1.00
R2301:Dnhd1	UTSW	7	105705399	missense	probably damaging	1.00
R2316:Dnhd1	UTSW	7	105674421	missense	probably damaging	1.00
R2324:Dnhd1	UTSW	7	105710090	missense	probably damaging	1.00
R2337:Dnhd1	UTSW	7	105703467	missense	probably benign	0.07
R2381:Dnhd1	UTSW	7	105693664	missense	probably benign	0.42
R2394:Dnhd1	UTSW	7	105720231	missense	probably benign	0.19
R2862:Dnhd1	UTSW	7	105712559	missense	probably benign	0.01
R3038:Dnhd1	UTSW	7	105720229	missense	probably damaging	0.99
R3114:Dnhd1	UTSW	7	105696565	critical splice donor site	probably null
R3404:Dnhd1	UTSW	7	105694761	nonsense	probably null
R3405:Dnhd1	UTSW	7	105694761	nonsense	probably null
R3439:Dnhd1	UTSW	7	105694785	missense	probably damaging	1.00
R3959:Dnhd1	UTSW	7	105713122	missense	probably benign	0.21
R4014:Dnhd1	UTSW	7	105714838	missense	probably damaging	0.99
R4084:Dnhd1	UTSW	7	105709588	missense	probably damaging	1.00
R4181:Dnhd1	UTSW	7	105693954	missense	probably damaging	1.00
R4255:Dnhd1	UTSW	7	105712998	missense	probably damaging	1.00
R4302:Dnhd1	UTSW	7	105693954	missense	probably damaging	1.00
R4440:Dnhd1	UTSW	7	105696728	nonsense	probably null
R4565:Dnhd1	UTSW	7	105651956	missense	possibly damaging	0.92
R4569:Dnhd1	UTSW	7	105657166	splice site	probably null
R4584:Dnhd1	UTSW	7	105678049	missense	probably damaging	1.00
R4586:Dnhd1	UTSW	7	105678049	missense	probably damaging	1.00
R4590:Dnhd1	UTSW	7	105714030	missense	probably damaging	1.00
R4593:Dnhd1	UTSW	7	105715446	missense	probably benign	0.02
R4600:Dnhd1	UTSW	7	105703644	missense	probably damaging	1.00
R4705:Dnhd1	UTSW	7	105655741	missense	probably damaging	1.00
R4731:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4732:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4733:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4786:Dnhd1	UTSW	7	105674444	missense	probably benign	0.00
R4791:Dnhd1	UTSW	7	105721117	missense	probably damaging	1.00
R4811:Dnhd1	UTSW	7	105714281	missense	probably damaging	0.99
R4822:Dnhd1	UTSW	7	105703964	missense	probably benign	0.00
R4886:Dnhd1	UTSW	7	105714808	missense	probably benign	0.00
R4890:Dnhd1	UTSW	7	105656957	missense	possibly damaging	0.47
R4973:Dnhd1	UTSW	7	105713633	missense	probably benign	0.24
R5007:Dnhd1	UTSW	7	105713076	missense	probably damaging	1.00
R5048:Dnhd1	UTSW	7	105693697	missense	probably benign	0.01
R5151:Dnhd1	UTSW	7	105713440	missense	probably benign	0.22
R5179:Dnhd1	UTSW	7	105714552	missense	probably damaging	1.00
R5182:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5183:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5185:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5209:Dnhd1	UTSW	7	105696460	missense	probably benign	0.00
R5225:Dnhd1	UTSW	7	105703923	missense	possibly damaging	0.73
R5250:Dnhd1	UTSW	7	105685761	missense	probably damaging	1.00
R5257:Dnhd1	UTSW	7	105674037	missense	probably benign
R5258:Dnhd1	UTSW	7	105674037	missense	probably benign
R5273:Dnhd1	UTSW	7	105714482	missense	probably damaging	0.99
R5396:Dnhd1	UTSW	7	105713684	missense	probably benign	0.00
R5453:Dnhd1	UTSW	7	105710123	missense	probably damaging	1.00
R5511:Dnhd1	UTSW	7	105714156	missense	probably damaging	1.00
R5518:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5523:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5528:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5529:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5561:Dnhd1	UTSW	7	105714821	missense	probably damaging	0.99
R5681:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5682:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5683:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5684:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5686:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5697:Dnhd1	UTSW	7	105674188	missense	probably damaging	1.00
R5789:Dnhd1	UTSW	7	105705010	missense	possibly damaging	0.50
R5790:Dnhd1	UTSW	7	105655774	missense	probably damaging	1.00
R5814:Dnhd1	UTSW	7	105719895	missense	possibly damaging	0.69
R5828:Dnhd1	UTSW	7	105720181	missense	probably benign	0.00
R5852:Dnhd1	UTSW	7	105695748	missense	probably damaging	1.00
R5883:Dnhd1	UTSW	7	105720504	missense	probably damaging	0.98
R6115:Dnhd1	UTSW	7	105713987	missense	probably benign	0.00
R6119:Dnhd1	UTSW	7	105709440	missense	probably benign	0.18
R6212:Dnhd1	UTSW	7	105704048	missense	probably damaging	1.00
R6243:Dnhd1	UTSW	7	105652009	missense	probably damaging	1.00
R6265:Dnhd1	UTSW	7	105693370	missense	probably benign	0.07
R6332:Dnhd1	UTSW	7	105694066	missense	probably benign	0.02
R6344:Dnhd1	UTSW	7	105694610	missense	probably benign	0.38
R6477:Dnhd1	UTSW	7	105677886	missense	probably benign	0.05
R6642:Dnhd1	UTSW	7	105703799	missense	probably benign
R6663:Dnhd1	UTSW	7	105685692	splice site	probably null
R6730:Dnhd1	UTSW	7	105703875	missense	probably benign	0.00
R6748:Dnhd1	UTSW	7	105720637	missense	probably benign	0.03
R6833:Dnhd1	UTSW	7	105703373	missense	probably benign	0.01
R6850:Dnhd1	UTSW	7	105719930	missense	possibly damaging	0.68
R6853:Dnhd1	UTSW	7	105703728	missense	probably benign
R6860:Dnhd1	UTSW	7	105678266	missense	probably benign
R6898:Dnhd1	UTSW	7	105687377	missense	probably damaging	0.99
R6927:Dnhd1	UTSW	7	105715563	missense	probably damaging	1.00
R6952:Dnhd1	UTSW	7	105713688	missense	probably damaging	1.00
R6987:Dnhd1	UTSW	7	105704585	missense	probably damaging	0.98
R6988:Dnhd1	UTSW	7	105714210	missense	probably damaging	1.00
R7022:Dnhd1	UTSW	7	105720798	missense	probably benign	0.36
R7053:Dnhd1	UTSW	7	105694954	missense	probably damaging	1.00
R7085:Dnhd1	UTSW	7	105715261	missense	probably benign	0.26
R7086:Dnhd1	UTSW	7	105708532	missense	probably benign	0.03
R7112:Dnhd1	UTSW	7	105713985	missense	probably damaging	1.00
R7140:Dnhd1	UTSW	7	105693766	missense	probably benign	0.00
R7151:Dnhd1	UTSW	7	105710027	missense	probably benign	0.03
R7178:Dnhd1	UTSW	7	105694993	missense	probably damaging	0.98
R7326:Dnhd1	UTSW	7	105720930	missense	probably damaging	0.96
R7345:Dnhd1	UTSW	7	105703967	missense	probably benign	0.17
R7349:Dnhd1	UTSW	7	105710123	missense	probably damaging	1.00
R7397:Dnhd1	UTSW	7	105705297	missense	possibly damaging	0.87
R7520:Dnhd1	UTSW	7	105696048	missense	probably benign	0.07
R7536:Dnhd1	UTSW	7	105709561	missense	probably damaging	1.00
R7539:Dnhd1	UTSW	7	105720912	missense	probably damaging	1.00
R7541:Dnhd1	UTSW	7	105678309	missense	probably damaging	1.00
R7619:Dnhd1	UTSW	7	105674268	missense	probably benign	0.01
R7676:Dnhd1	UTSW	7	105684087	missense	probably benign	0.09
R7689:Dnhd1	UTSW	7	105713963	missense	probably benign	0.07
R7712:Dnhd1	UTSW	7	105651624	missense	probably benign	0.17
R7729:Dnhd1	UTSW	7	105705265	missense	probably damaging	1.00
R7767:Dnhd1	UTSW	7	105694610	missense	probably benign	0.38
R7768:Dnhd1	UTSW	7	105721095	missense	possibly damaging	0.87
R7779:Dnhd1	UTSW	7	105677915	missense	probably benign	0.01
R7879:Dnhd1	UTSW	7	105703439	missense	probably benign	0.09
R7922:Dnhd1	UTSW	7	105668514	missense	probably damaging	1.00
R7951:Dnhd1	UTSW	7	105678004	missense	probably damaging	1.00
R8259:Dnhd1	UTSW	7	105694788	missense	probably benign	0.38
R8350:Dnhd1	UTSW	7	105678024	missense	probably damaging	0.99
R8380:Dnhd1	UTSW	7	105677866	missense	probably benign	0.31
R8392:Dnhd1	UTSW	7	105703343	missense	possibly damaging	0.84
R8478:Dnhd1	UTSW	7	105682794	missense	probably benign	0.00
R8708:Dnhd1	UTSW	7	105694280	nonsense	probably null
R8767:Dnhd1	UTSW	7	105652123	missense	probably damaging	1.00
R8825:Dnhd1	UTSW	7	105693967	missense	possibly damaging	0.95
R8849:Dnhd1	UTSW	7	105721516	missense	probably benign	0.00
R8903:Dnhd1	UTSW	7	105713648	nonsense	probably null
R8910:Dnhd1	UTSW	7	105683697	missense	possibly damaging	0.92
R8940:Dnhd1	UTSW	7	105714647	intron	probably benign
R8954:Dnhd1	UTSW	7	105694779	missense	probably benign	0.35
R8956:Dnhd1	UTSW	7	105692645	missense	probably damaging	0.99
R8971:Dnhd1	UTSW	7	105709321	nonsense	probably null
R8996:Dnhd1	UTSW	7	105674035	missense	probably damaging	1.00
R9051:Dnhd1	UTSW	7	105692726	missense	possibly damaging	0.54
R9058:Dnhd1	UTSW	7	105684063	missense	probably benign	0.01
R9109:Dnhd1	UTSW	7	105683966	missense	probably damaging	0.98
R9284:Dnhd1	UTSW	7	105651884	missense	probably damaging	1.00
R9295:Dnhd1	UTSW	7	105714141	missense	probably benign
R9298:Dnhd1	UTSW	7	105683966	missense	probably damaging	0.98
R9299:Dnhd1	UTSW	7	105720599	missense	probably benign	0.00
R9308:Dnhd1	UTSW	7	105704277	missense	probably damaging	1.00
R9337:Dnhd1	UTSW	7	105720599	missense	probably benign	0.00
R9385:Dnhd1	UTSW	7	105712765	missense	probably damaging	1.00
R9463:Dnhd1	UTSW	7	105657247	missense	probably benign	0.00
R9463:Dnhd1	UTSW	7	105695016	missense	probably benign
R9476:Dnhd1	UTSW	7	105703682	missense	possibly damaging	0.74
R9489:Dnhd1	UTSW	7	105651597	missense	probably benign
R9500:Dnhd1	UTSW	7	105704502	missense	probably benign
R9510:Dnhd1	UTSW	7	105703682	missense	possibly damaging	0.74
R9513:Dnhd1	UTSW	7	105704972	missense	probably damaging	1.00
R9537:Dnhd1	UTSW	7	105695533	missense	probably damaging	0.99
R9567:Dnhd1	UTSW	7	105704266	missense	probably benign	0.03
R9622:Dnhd1	UTSW	7	105704135	missense	probably benign
R9623:Dnhd1	UTSW	7	105686566	missense	probably damaging	1.00
R9623:Dnhd1	UTSW	7	105694927	missense	probably damaging	1.00
R9674:Dnhd1	UTSW	7	105714222	missense	probably damaging	1.00
R9756:Dnhd1	UTSW	7	105703928	missense	probably benign	0.19
R9777:Dnhd1	UTSW	7	105720249	missense	probably benign	0.14
R9778:Dnhd1	UTSW	7	105704033	missense	probably benign
R9781:Dnhd1	UTSW	7	105703710	missense	probably benign	0.31
R9796:Dnhd1	UTSW	7	105693330	missense	probably damaging	1.00
Z1088:Dnhd1	UTSW	7	105712727	missense	probably benign	0.00
Z1176:Dnhd1	UTSW	7	105668547	missense	probably damaging	0.98
Z1176:Dnhd1	UTSW	7	105678299	missense	probably benign
Z1176:Dnhd1	UTSW	7	105703036	critical splice acceptor site	probably null
Z1176:Dnhd1	UTSW	7	105703580	frame shift	probably null
Z1177:Dnhd1	UTSW	7	105682841	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TGGAGCATTGGAACTGTTGC -3'
(R):5'- CTGGGCCAAGTAACTAGATCC -3'

Sequencing Primer
(F):5'- TGAATCCCTGGCAGGTCACTC -3'
(R):5'- CAAACCTTTTCGTGATTGGCAG -3'

Posted On

2016-08-04