Incidental Mutation 'R5288:Nav3'
ID424512
Institutional Source Beutler Lab
Gene Symbol Nav3
Ensembl Gene ENSMUSG00000020181
Gene Nameneuron navigator 3
SynonymsPOMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p
MMRRC Submission 042842-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5288 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location109681259-110456204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109853105 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 437 (N437S)
Ref Sequence ENSEMBL: ENSMUSP00000032719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032719]
Predicted Effect probably benign
Transcript: ENSMUST00000032719
AA Change: N437S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: N437S

DomainStartEndE-ValueType
CH 79 182 4.41e-12 SMART
low complexity region 184 194 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 353 363 N/A INTRINSIC
low complexity region 427 439 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 904 916 N/A INTRINSIC
low complexity region 1077 1095 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1207 1229 N/A INTRINSIC
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1274 1285 N/A INTRINSIC
low complexity region 1293 1312 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
low complexity region 1462 1474 N/A INTRINSIC
low complexity region 1550 1563 N/A INTRINSIC
coiled coil region 1565 1656 N/A INTRINSIC
low complexity region 1675 1692 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
low complexity region 1756 1781 N/A INTRINSIC
low complexity region 1782 1795 N/A INTRINSIC
coiled coil region 1801 1842 N/A INTRINSIC
low complexity region 1848 1871 N/A INTRINSIC
AAA 2029 2184 4.94e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T G 16: 13,677,758 N240K probably benign Het
Abcc12 A T 8: 86,566,539 Y7N probably damaging Het
Adcy1 A C 11: 7,161,351 I881L probably benign Het
Aftph T C 11: 20,726,994 D205G probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
C87414 C T 5: 93,637,748 M224I possibly damaging Het
Ccdc88a T G 11: 29,498,416 N1465K possibly damaging Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cep70 T A 9: 99,281,075 L325Q probably damaging Het
Cfap46 A G 7: 139,613,507 probably null Het
Cftr C T 6: 18,226,129 Q359* probably null Het
Chrne A T 11: 70,615,087 N457K possibly damaging Het
Cntn2 A G 1: 132,523,677 I438T probably benign Het
Cntn4 T C 6: 106,181,804 L10P possibly damaging Het
Copg1 G T 6: 87,890,207 M87I possibly damaging Het
Cyfip1 A T 7: 55,925,135 M1045L possibly damaging Het
Cyp2c29 C T 19: 39,330,372 P432L probably damaging Het
Dcaf11 T A 14: 55,563,376 D96E probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnhd1 G A 7: 105,714,437 E4069K possibly damaging Het
Dpy19l4 T A 4: 11,289,721 N330I probably damaging Het
Dpy19l4 G T 4: 11,304,014 A132D probably damaging Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp11 T C 6: 85,947,605 *322W probably null Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Eml3 G A 19: 8,939,274 G720S probably damaging Het
F11 A G 8: 45,246,796 S418P probably damaging Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fat2 G A 11: 55,267,656 T3412I probably benign Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Gm10134 T A 2: 28,506,360 probably benign Het
Gm11787 T C 4: 3,511,795 noncoding transcript Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hephl1 T C 9: 15,076,854 T653A possibly damaging Het
Herc3 T A 6: 58,874,278 M504K probably damaging Het
Hmcn2 A G 2: 31,460,321 T5077A probably benign Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Ighe T C 12: 113,271,472 H356R probably benign Het
Ighv10-3 T A 12: 114,523,505 M99L probably benign Het
Izumo4 C A 10: 80,702,805 C30* probably null Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kif24 T C 4: 41,395,373 E500G probably benign Het
Kng1 A T 16: 23,079,092 D414V probably damaging Het
Loxhd1 A C 18: 77,363,612 D410A probably damaging Het
Ltn1 T C 16: 87,416,011 K554R possibly damaging Het
Ly75 A G 2: 60,303,641 C1547R probably damaging Het
Ms4a6d A T 19: 11,587,136 S124T possibly damaging Het
Mtfr2 A G 10: 20,357,702 D339G probably damaging Het
Myh10 T A 11: 68,801,608 L1369Q probably damaging Het
Myh11 A T 16: 14,208,008 V1366D possibly damaging Het
Nadsyn1 A G 7: 143,803,286 V491A possibly damaging Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Neb A T 2: 52,189,861 I85N probably damaging Het
Nktr A G 9: 121,748,593 K576E probably benign Het
Nmur2 T A 11: 56,040,214 I224F probably damaging Het
Oas3 A G 5: 120,756,990 F978S probably damaging Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1331 T C 4: 118,869,575 S264P probably damaging Het
Olfr330 A T 11: 58,529,482 M168K probably damaging Het
Olfr457 T A 6: 42,471,252 I309F probably benign Het
Olfr484 T C 7: 108,125,168 T32A probably benign Het
Pcyox1 A T 6: 86,392,354 probably null Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pitpnm1 T C 19: 4,103,435 F197S probably damaging Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Pomt1 C G 2: 32,244,299 Y277* probably null Het
Pou4f2 A G 8: 78,436,329 Y26H unknown Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Prdx2 T A 8: 84,971,673 Y164* probably null Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Rab4a A T 8: 123,827,374 I16L probably benign Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Rimbp2 G A 5: 128,788,592 T557M probably benign Het
Rmi1 G A 13: 58,409,466 G510R probably damaging Het
Sdad1 A G 5: 92,286,825 *687Q probably null Het
Sema6d T C 2: 124,664,246 L720P probably damaging Het
Setx T G 2: 29,134,033 probably null Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Strn3 C G 12: 51,648,020 R320P probably damaging Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Syne2 T A 12: 76,099,338 S6377T possibly damaging Het
Tas2r123 A T 6: 132,847,227 H29L probably benign Het
Tbl3 C T 17: 24,705,970 V52M possibly damaging Het
Tbp A G 17: 15,507,347 I145V probably benign Het
Tcf20 A T 15: 82,855,709 S514T possibly damaging Het
Tgm4 A G 9: 123,056,494 Y367C probably damaging Het
Tle1 C T 4: 72,141,844 V258M probably damaging Het
Tln1 C T 4: 43,540,661 V1447I probably benign Het
Tnfrsf11b C T 15: 54,278,226 A8T probably benign Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Tsen15 C T 1: 152,383,380 V76I probably damaging Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Ucn3 A T 13: 3,941,474 F59L probably benign Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vmn2r94 A C 17: 18,244,466 Y521D probably damaging Het
Vps45 T C 3: 96,057,774 M1V probably null Het
Vta1 C A 10: 14,705,399 L21F probably damaging Het
Zdhhc21 C T 4: 82,847,692 G2D probably damaging Het
Zfp169 A T 13: 48,490,275 C459S possibly damaging Het
Zfp90 C T 8: 106,425,368 T571M probably damaging Het
Zswim8 A T 14: 20,718,871 N1119I possibly damaging Het
Other mutations in Nav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nav3 APN 10 109841733 missense probably damaging 0.99
IGL00425:Nav3 APN 10 109703507 missense probably benign 0.13
IGL00465:Nav3 APN 10 109852746 missense probably damaging 0.99
IGL00531:Nav3 APN 10 109703310 missense probably null 0.99
IGL00575:Nav3 APN 10 109764765 missense probably damaging 0.98
IGL00770:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00774:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00858:Nav3 APN 10 109742632 missense probably damaging 0.98
IGL00935:Nav3 APN 10 109705666 missense probably benign
IGL01638:Nav3 APN 10 109852863 missense probably damaging 1.00
IGL01662:Nav3 APN 10 109769258 missense possibly damaging 0.56
IGL01670:Nav3 APN 10 109714241 missense possibly damaging 0.92
IGL01885:Nav3 APN 10 109742660 nonsense probably null
IGL01979:Nav3 APN 10 109704929 missense probably benign 0.01
IGL02121:Nav3 APN 10 109759036 missense probably damaging 0.99
IGL02210:Nav3 APN 10 109766990 missense probably benign
IGL02523:Nav3 APN 10 109769296 missense probably damaging 1.00
IGL02573:Nav3 APN 10 109866974 missense probably benign 0.23
IGL02633:Nav3 APN 10 109692136 missense probably benign 0.09
IGL02810:Nav3 APN 10 109816274 missense probably damaging 1.00
IGL02964:Nav3 APN 10 109736953 missense probably damaging 0.99
IGL03015:Nav3 APN 10 109718297 missense probably damaging 0.98
IGL03288:Nav3 APN 10 109759017 missense probably damaging 1.00
IGL03310:Nav3 APN 10 109824572 critical splice donor site probably null
PIT4377001:Nav3 UTSW 10 109716605 missense probably damaging 0.99
R0010:Nav3 UTSW 10 109823226 splice site probably benign
R0043:Nav3 UTSW 10 109767518 missense possibly damaging 0.95
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0077:Nav3 UTSW 10 109716642 missense possibly damaging 0.87
R0219:Nav3 UTSW 10 109866930 critical splice donor site probably null
R0310:Nav3 UTSW 10 109767128 missense possibly damaging 0.82
R0380:Nav3 UTSW 10 109758879 splice site probably benign
R0403:Nav3 UTSW 10 109767103 missense probably damaging 0.98
R0480:Nav3 UTSW 10 109853300 missense probably damaging 1.00
R0626:Nav3 UTSW 10 109823464 missense probably damaging 1.00
R0637:Nav3 UTSW 10 109770197 missense probably benign 0.25
R0847:Nav3 UTSW 10 109903857 missense possibly damaging 0.94
R0988:Nav3 UTSW 10 109716528 missense probably damaging 1.00
R1272:Nav3 UTSW 10 109736999 missense probably damaging 0.98
R1295:Nav3 UTSW 10 109692102 missense probably damaging 1.00
R1405:Nav3 UTSW 10 109770333 splice site probably benign
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1420:Nav3 UTSW 10 109823254 missense probably benign 0.02
R1449:Nav3 UTSW 10 109853511 missense probably benign 0.13
R1458:Nav3 UTSW 10 109720044 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1472:Nav3 UTSW 10 109727941 missense probably damaging 0.99
R1537:Nav3 UTSW 10 109866985 missense probably damaging 1.00
R1539:Nav3 UTSW 10 109767170 missense probably damaging 0.99
R1581:Nav3 UTSW 10 109823428 missense probably damaging 1.00
R1586:Nav3 UTSW 10 109853254 missense probably damaging 1.00
R1654:Nav3 UTSW 10 109853123 missense possibly damaging 0.85
R1725:Nav3 UTSW 10 109823590 missense probably damaging 1.00
R1742:Nav3 UTSW 10 109769213 missense probably benign
R1793:Nav3 UTSW 10 109703372 missense probably benign 0.00
R1830:Nav3 UTSW 10 109823323 missense probably damaging 1.00
R1834:Nav3 UTSW 10 109720022 missense probably damaging 0.99
R1881:Nav3 UTSW 10 109852559 missense probably damaging 0.96
R1922:Nav3 UTSW 10 109705606 missense probably benign 0.43
R1944:Nav3 UTSW 10 109716530 missense probably damaging 0.99
R1981:Nav3 UTSW 10 109719090 splice site probably benign
R1985:Nav3 UTSW 10 109770184 splice site probably benign
R1996:Nav3 UTSW 10 109853401 missense probably damaging 1.00
R2051:Nav3 UTSW 10 109824675 missense probably damaging 0.99
R2062:Nav3 UTSW 10 109720021 missense probably damaging 1.00
R2139:Nav3 UTSW 10 109853135 missense probably benign 0.22
R2248:Nav3 UTSW 10 109696227 missense probably damaging 1.00
R2420:Nav3 UTSW 10 109863813 missense probably damaging 0.98
R2444:Nav3 UTSW 10 109764915 missense probably benign 0.09
R3026:Nav3 UTSW 10 109824604 missense probably damaging 0.99
R3052:Nav3 UTSW 10 109903752 missense probably damaging 0.99
R3441:Nav3 UTSW 10 109704928 missense probably benign 0.01
R3845:Nav3 UTSW 10 109853376 missense possibly damaging 0.82
R3929:Nav3 UTSW 10 109684203 missense probably damaging 1.00
R3932:Nav3 UTSW 10 109694035 missense probably damaging 0.99
R4056:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4057:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4120:Nav3 UTSW 10 109903744 critical splice donor site probably null
R4244:Nav3 UTSW 10 109769296 missense probably damaging 1.00
R4361:Nav3 UTSW 10 109852986 missense probably damaging 1.00
R4512:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4514:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4700:Nav3 UTSW 10 109764935 missense probably benign 0.10
R4815:Nav3 UTSW 10 109823552 missense probably benign
R4981:Nav3 UTSW 10 109880692 missense probably benign
R5042:Nav3 UTSW 10 109769268 missense probably benign 0.27
R5251:Nav3 UTSW 10 109853253 missense probably damaging 0.99
R5252:Nav3 UTSW 10 109714291 small deletion probably benign
R5273:Nav3 UTSW 10 109693038 critical splice donor site probably null
R5407:Nav3 UTSW 10 109866935 missense probably benign 0.28
R5533:Nav3 UTSW 10 109883678 missense possibly damaging 0.61
R5561:Nav3 UTSW 10 109716552 missense probably damaging 1.00
R5577:Nav3 UTSW 10 109769403 missense probably damaging 1.00
R5656:Nav3 UTSW 10 109764633 missense probably damaging 0.96
R5872:Nav3 UTSW 10 109764787 missense probably damaging 1.00
R6023:Nav3 UTSW 10 109823515 missense possibly damaging 0.95
R6061:Nav3 UTSW 10 109866984 nonsense probably null
R6189:Nav3 UTSW 10 109720019 missense probably damaging 0.98
R6214:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6215:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6264:Nav3 UTSW 10 109688833 missense probably damaging 0.97
R6500:Nav3 UTSW 10 109764756 missense probably damaging 1.00
R6524:Nav3 UTSW 10 109720030 missense probably damaging 0.99
R6868:Nav3 UTSW 10 109693166 missense possibly damaging 0.49
R7079:Nav3 UTSW 10 109767292 missense probably benign 0.16
R7099:Nav3 UTSW 10 109703334 missense probably benign 0.11
R7139:Nav3 UTSW 10 109853477 missense probably benign 0.44
R7238:Nav3 UTSW 10 109853324 missense possibly damaging 0.75
R7338:Nav3 UTSW 10 109769212 missense probably benign 0.04
R7343:Nav3 UTSW 10 109903758 missense probably damaging 0.98
R7383:Nav3 UTSW 10 109716671 missense probably damaging 0.98
R7391:Nav3 UTSW 10 109703456 missense probably benign 0.07
R7399:Nav3 UTSW 10 109852934 missense possibly damaging 0.74
R7457:Nav3 UTSW 10 109696328 nonsense probably null
R7462:Nav3 UTSW 10 109823578 missense probably damaging 1.00
R7542:Nav3 UTSW 10 109823533 missense possibly damaging 0.89
R7659:Nav3 UTSW 10 109766990 missense probably benign 0.09
R7749:Nav3 UTSW 10 109703352 missense probably damaging 0.99
R7794:Nav3 UTSW 10 109688856 missense probably benign 0.08
R7876:Nav3 UTSW 10 109853498 missense probably benign 0.26
R8048:Nav3 UTSW 10 109764918 missense probably benign 0.13
R8104:Nav3 UTSW 10 109758967 missense probably damaging 0.99
R8125:Nav3 UTSW 10 109852659 missense probably damaging 0.99
R8275:Nav3 UTSW 10 109692123 missense noncoding transcript
R8325:Nav3 UTSW 10 109705603 missense probably benign 0.24
R8336:Nav3 UTSW 10 109767569 missense probably damaging 0.99
R8523:Nav3 UTSW 10 109823277 missense probably damaging 1.00
R8529:Nav3 UTSW 10 109853331 missense probably benign 0.09
X0012:Nav3 UTSW 10 109692097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATTCCACTGGACGATGG -3'
(R):5'- GCTCCTTCGGGACAGAAATC -3'

Sequencing Primer
(F):5'- CCACTGGACGATGGAATTAAGCTTTC -3'
(R):5'- CCTTCGGGACAGAAATCTATGCTTG -3'
Posted On2016-08-04