Incidental Mutation 'R5288:Myh10'
ID424523
Institutional Source Beutler Lab
Gene Symbol Myh10
Ensembl Gene ENSMUSG00000020900
Gene Namemyosin, heavy polypeptide 10, non-muscle
SynonymsMyosin IIB, Fltn, Fltn, Myhn-2, myosin IIB, nonmuscle myosin heavy chain II-B, NMHC-B, Myhn2, SMemb, NMHC II-B, 5730504C04Rik, nonmuscle myosin heavy chain IIB, 9330167F11Rik
MMRRC Submission 042842-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5288 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68691559-68816632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68801608 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1369 (L1369Q)
Ref Sequence ENSEMBL: ENSMUSP00000090661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018887] [ENSMUST00000092984] [ENSMUST00000102611]
Predicted Effect probably damaging
Transcript: ENSMUST00000018887
AA Change: L1363Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018887
Gene: ENSMUSG00000020900
AA Change: L1363Q

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.5e-15 PFAM
MYSc 79 815 N/A SMART
IQ 816 838 4.81e-4 SMART
low complexity region 932 946 N/A INTRINSIC
low complexity region 984 994 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1070 1086 N/A INTRINSIC
Pfam:Myosin_tail_1 1104 1961 6.5e-211 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092984
AA Change: L1369Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090661
Gene: ENSMUSG00000020900
AA Change: L1369Q

DomainStartEndE-ValueType
Pfam:Myosin_N 70 110 2.5e-13 PFAM
MYSc 116 821 N/A SMART
IQ 822 844 4.81e-4 SMART
Pfam:Myosin_tail_1 885 1965 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102611
AA Change: L1332Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099671
Gene: ENSMUSG00000020900
AA Change: L1332Q

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.4e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 4.81e-4 SMART
low complexity region 901 915 N/A INTRINSIC
low complexity region 953 963 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1039 1055 N/A INTRINSIC
Pfam:Myosin_tail_1 1073 1930 6.2e-211 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Nullizygous mice show pre- and neonatal death, heart defects and hydrocephaly. Deletion of exon B1 disrupts migration of facial neurons, whereas deletion of exon B2 leads to Purkinje cell anomalies. Hypomorphs show hydrocephaly and defects in motor control, cerebellar foliation and neuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T G 16: 13,677,758 N240K probably benign Het
Abcc12 A T 8: 86,566,539 Y7N probably damaging Het
Adcy1 A C 11: 7,161,351 I881L probably benign Het
Aftph T C 11: 20,726,994 D205G probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
C87414 C T 5: 93,637,748 M224I possibly damaging Het
Ccdc88a T G 11: 29,498,416 N1465K possibly damaging Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cep70 T A 9: 99,281,075 L325Q probably damaging Het
Cfap46 A G 7: 139,613,507 probably null Het
Cftr C T 6: 18,226,129 Q359* probably null Het
Chrne A T 11: 70,615,087 N457K possibly damaging Het
Cntn2 A G 1: 132,523,677 I438T probably benign Het
Cntn4 T C 6: 106,181,804 L10P possibly damaging Het
Copg1 G T 6: 87,890,207 M87I possibly damaging Het
Cyfip1 A T 7: 55,925,135 M1045L possibly damaging Het
Cyp2c29 C T 19: 39,330,372 P432L probably damaging Het
Dcaf11 T A 14: 55,563,376 D96E probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnhd1 G A 7: 105,714,437 E4069K possibly damaging Het
Dpy19l4 T A 4: 11,289,721 N330I probably damaging Het
Dpy19l4 G T 4: 11,304,014 A132D probably damaging Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp11 T C 6: 85,947,605 *322W probably null Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Eml3 G A 19: 8,939,274 G720S probably damaging Het
F11 A G 8: 45,246,796 S418P probably damaging Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fat2 G A 11: 55,267,656 T3412I probably benign Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Gm10134 T A 2: 28,506,360 probably benign Het
Gm11787 T C 4: 3,511,795 noncoding transcript Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hephl1 T C 9: 15,076,854 T653A possibly damaging Het
Herc3 T A 6: 58,874,278 M504K probably damaging Het
Hmcn2 A G 2: 31,460,321 T5077A probably benign Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Ighe T C 12: 113,271,472 H356R probably benign Het
Ighv10-3 T A 12: 114,523,505 M99L probably benign Het
Izumo4 C A 10: 80,702,805 C30* probably null Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kif24 T C 4: 41,395,373 E500G probably benign Het
Kng1 A T 16: 23,079,092 D414V probably damaging Het
Loxhd1 A C 18: 77,363,612 D410A probably damaging Het
Ltn1 T C 16: 87,416,011 K554R possibly damaging Het
Ly75 A G 2: 60,303,641 C1547R probably damaging Het
Ms4a6d A T 19: 11,587,136 S124T possibly damaging Het
Mtfr2 A G 10: 20,357,702 D339G probably damaging Het
Myh11 A T 16: 14,208,008 V1366D possibly damaging Het
Nadsyn1 A G 7: 143,803,286 V491A possibly damaging Het
Nav3 T C 10: 109,853,105 N437S probably benign Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Neb A T 2: 52,189,861 I85N probably damaging Het
Nktr A G 9: 121,748,593 K576E probably benign Het
Nmur2 T A 11: 56,040,214 I224F probably damaging Het
Oas3 A G 5: 120,756,990 F978S probably damaging Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1331 T C 4: 118,869,575 S264P probably damaging Het
Olfr330 A T 11: 58,529,482 M168K probably damaging Het
Olfr457 T A 6: 42,471,252 I309F probably benign Het
Olfr484 T C 7: 108,125,168 T32A probably benign Het
Pcyox1 A T 6: 86,392,354 probably null Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pitpnm1 T C 19: 4,103,435 F197S probably damaging Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Pomt1 C G 2: 32,244,299 Y277* probably null Het
Pou4f2 A G 8: 78,436,329 Y26H unknown Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Prdx2 T A 8: 84,971,673 Y164* probably null Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Rab4a A T 8: 123,827,374 I16L probably benign Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Rimbp2 G A 5: 128,788,592 T557M probably benign Het
Rmi1 G A 13: 58,409,466 G510R probably damaging Het
Sdad1 A G 5: 92,286,825 *687Q probably null Het
Sema6d T C 2: 124,664,246 L720P probably damaging Het
Setx T G 2: 29,134,033 probably null Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Strn3 C G 12: 51,648,020 R320P probably damaging Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Syne2 T A 12: 76,099,338 S6377T possibly damaging Het
Tas2r123 A T 6: 132,847,227 H29L probably benign Het
Tbl3 C T 17: 24,705,970 V52M possibly damaging Het
Tbp A G 17: 15,507,347 I145V probably benign Het
Tcf20 A T 15: 82,855,709 S514T possibly damaging Het
Tgm4 A G 9: 123,056,494 Y367C probably damaging Het
Tle1 C T 4: 72,141,844 V258M probably damaging Het
Tln1 C T 4: 43,540,661 V1447I probably benign Het
Tnfrsf11b C T 15: 54,278,226 A8T probably benign Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Tsen15 C T 1: 152,383,380 V76I probably damaging Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Ucn3 A T 13: 3,941,474 F59L probably benign Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vmn2r94 A C 17: 18,244,466 Y521D probably damaging Het
Vps45 T C 3: 96,057,774 M1V probably null Het
Vta1 C A 10: 14,705,399 L21F probably damaging Het
Zdhhc21 C T 4: 82,847,692 G2D probably damaging Het
Zfp169 A T 13: 48,490,275 C459S possibly damaging Het
Zfp90 C T 8: 106,425,368 T571M probably damaging Het
Zswim8 A T 14: 20,718,871 N1119I possibly damaging Het
Other mutations in Myh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myh10 APN 11 68790708 missense probably benign 0.10
IGL01132:Myh10 APN 11 68768268 missense possibly damaging 0.93
IGL01348:Myh10 APN 11 68811803 missense probably benign 0.04
IGL01404:Myh10 APN 11 68752040 splice site probably null
IGL01409:Myh10 APN 11 68807219 missense probably damaging 0.98
IGL01660:Myh10 APN 11 68785889 missense probably benign 0.00
IGL02111:Myh10 APN 11 68790112 missense probably damaging 1.00
IGL02481:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02483:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02502:Myh10 APN 11 68814372 splice site probably null
IGL03178:Myh10 APN 11 68699413 missense probably benign 0.19
algia UTSW 11 68802931 missense probably damaging 1.00
itis UTSW 11 68764245 missense probably damaging 0.96
PIT4802001:Myh10 UTSW 11 68765092 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0517:Myh10 UTSW 11 68811599 critical splice acceptor site probably null
R0855:Myh10 UTSW 11 68811801 missense possibly damaging 0.88
R1110:Myh10 UTSW 11 68791850 splice site probably benign
R1135:Myh10 UTSW 11 68807197 missense probably benign
R1169:Myh10 UTSW 11 68762841 missense probably damaging 0.99
R1643:Myh10 UTSW 11 68792010 missense probably damaging 0.96
R1733:Myh10 UTSW 11 68802296 missense probably benign 0.06
R1754:Myh10 UTSW 11 68813058 missense probably damaging 0.98
R1859:Myh10 UTSW 11 68745413 missense probably benign 0.03
R1898:Myh10 UTSW 11 68771906 missense probably damaging 1.00
R1905:Myh10 UTSW 11 68771868 splice site probably benign
R1914:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1915:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1987:Myh10 UTSW 11 68814496 missense possibly damaging 0.56
R2130:Myh10 UTSW 11 68807289 splice site probably benign
R2132:Myh10 UTSW 11 68807289 splice site probably benign
R2136:Myh10 UTSW 11 68804714 missense probably damaging 1.00
R2214:Myh10 UTSW 11 68783127 missense probably damaging 1.00
R2351:Myh10 UTSW 11 68793139 missense probably damaging 1.00
R3407:Myh10 UTSW 11 68790211 missense possibly damaging 0.68
R3721:Myh10 UTSW 11 68813052 missense probably damaging 0.99
R3908:Myh10 UTSW 11 68771059 critical splice donor site probably null
R4275:Myh10 UTSW 11 68751940 critical splice acceptor site probably null
R4526:Myh10 UTSW 11 68815049 missense probably benign 0.04
R4666:Myh10 UTSW 11 68801730 critical splice donor site probably null
R4668:Myh10 UTSW 11 68804642 missense probably damaging 1.00
R4750:Myh10 UTSW 11 68785314 missense probably damaging 1.00
R4968:Myh10 UTSW 11 68793223 missense probably damaging 1.00
R4977:Myh10 UTSW 11 68798371 missense possibly damaging 0.55
R5201:Myh10 UTSW 11 68783195 missense probably damaging 1.00
R5304:Myh10 UTSW 11 68764245 missense probably damaging 0.96
R5366:Myh10 UTSW 11 68760692 missense probably damaging 0.97
R5384:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5427:Myh10 UTSW 11 68802931 missense probably damaging 1.00
R5546:Myh10 UTSW 11 68798380 missense possibly damaging 0.90
R5551:Myh10 UTSW 11 68768287 missense possibly damaging 0.65
R5777:Myh10 UTSW 11 68785859 missense probably damaging 1.00
R5995:Myh10 UTSW 11 68814983 missense probably benign 0.01
R6021:Myh10 UTSW 11 68808862 missense possibly damaging 0.72
R6171:Myh10 UTSW 11 68791890 missense probably damaging 1.00
R6179:Myh10 UTSW 11 68802153 missense probably damaging 0.98
R6263:Myh10 UTSW 11 68810232 missense probably damaging 0.98
R6264:Myh10 UTSW 11 68745415 missense probably benign 0.01
R6484:Myh10 UTSW 11 68699467 missense probably damaging 1.00
R6575:Myh10 UTSW 11 68808850 missense probably benign 0.00
R6736:Myh10 UTSW 11 68745339 missense probably damaging 1.00
R7141:Myh10 UTSW 11 68802139 missense probably benign
R7256:Myh10 UTSW 11 68790689 missense probably damaging 1.00
R7329:Myh10 UTSW 11 68810191 missense probably benign 0.44
R7363:Myh10 UTSW 11 68815048 missense probably benign
R7576:Myh10 UTSW 11 68802166 missense probably damaging 1.00
R7577:Myh10 UTSW 11 68745980 missense unknown
R7681:Myh10 UTSW 11 68771936 missense probably damaging 0.98
R7813:Myh10 UTSW 11 68785909 missense probably benign 0.00
R7834:Myh10 UTSW 11 68785826 missense probably damaging 1.00
R7917:Myh10 UTSW 11 68785826 missense probably damaging 1.00
X0028:Myh10 UTSW 11 68793135 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGGCTGAGACTTATCCTATAG -3'
(R):5'- CTGTCCCTGCATACATCTAGGG -3'

Sequencing Primer
(F):5'- TATCCTATAGAGAGATGCCTGCC -3'
(R):5'- AGAGCCAACACCTGCTT -3'
Posted On2016-08-04