Incidental Mutation 'R5288:Zfp169'
ID 424535
Institutional Source Beutler Lab
Gene Symbol Zfp169
Ensembl Gene ENSMUSG00000050954
Gene Name zinc finger protein 169
Synonyms 4930429A13Rik, 1700025J14Rik
MMRRC Submission 042842-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R5288 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 48641123-48666927 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 48643751 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 459 (C459S)
Ref Sequence ENSEMBL: ENSMUSP00000135414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110110] [ENSMUST00000167682] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
AlphaFold E9Q3R6
Predicted Effect possibly damaging
Transcript: ENSMUST00000110110
AA Change: C459S

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105737
Gene: ENSMUSG00000050954
AA Change: C459S

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167682
SMART Domains Protein: ENSMUSP00000127591
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176176
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176949
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176996
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177474
Predicted Effect possibly damaging
Transcript: ENSMUST00000177530
AA Change: C459S

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954
AA Change: C459S

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus does not result in an overt phenotype early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A T 8: 87,293,168 (GRCm39) Y7N probably damaging Het
Adcy1 A C 11: 7,111,351 (GRCm39) I881L probably benign Het
Aftph T C 11: 20,676,994 (GRCm39) D205G probably damaging Het
Aldh7a1 T A 18: 56,667,325 (GRCm39) N316Y possibly damaging Het
Ankrd36 A G 11: 5,639,340 (GRCm39) probably benign Het
Ccdc88a T G 11: 29,448,416 (GRCm39) N1465K possibly damaging Het
Ccpg1 G A 9: 72,920,326 (GRCm39) S647N probably benign Het
Cep70 T A 9: 99,163,128 (GRCm39) L325Q probably damaging Het
Cfap46 A G 7: 139,193,423 (GRCm39) probably null Het
Cftr C T 6: 18,226,128 (GRCm39) Q359* probably null Het
Chrne A T 11: 70,505,913 (GRCm39) N457K possibly damaging Het
Cntn2 A G 1: 132,451,415 (GRCm39) I438T probably benign Het
Cntn4 T C 6: 106,158,765 (GRCm39) L10P possibly damaging Het
Copg1 G T 6: 87,867,189 (GRCm39) M87I possibly damaging Het
Cyfip1 A T 7: 55,574,883 (GRCm39) M1045L possibly damaging Het
Cyp2c29 C T 19: 39,318,816 (GRCm39) P432L probably damaging Het
Dcaf11 T A 14: 55,800,833 (GRCm39) D96E probably damaging Het
Dmxl2 A G 9: 54,286,041 (GRCm39) S2715P probably benign Het
Dnhd1 G A 7: 105,363,644 (GRCm39) E4069K possibly damaging Het
Dpy19l4 T A 4: 11,289,721 (GRCm39) N330I probably damaging Het
Dpy19l4 G T 4: 11,304,014 (GRCm39) A132D probably damaging Het
Duox2 A G 2: 122,125,617 (GRCm39) V330A probably benign Het
Dusp11 T C 6: 85,924,587 (GRCm39) *322W probably null Het
Dusp8 T A 7: 141,643,730 (GRCm39) Q61L possibly damaging Het
Eml3 G A 19: 8,916,638 (GRCm39) G720S probably damaging Het
F11 A G 8: 45,699,833 (GRCm39) S418P probably damaging Het
Fam91a1 G A 15: 58,320,243 (GRCm39) S645N probably benign Het
Fat2 G A 11: 55,158,482 (GRCm39) T3412I probably benign Het
Fbxo38 A G 18: 62,674,042 (GRCm39) M13T probably benign Het
Fbxo48 G T 11: 16,904,329 (GRCm39) L160F possibly damaging Het
Gm10134 T A 2: 28,396,372 (GRCm39) probably benign Het
Gm11787 T C 4: 3,511,795 (GRCm39) noncoding transcript Het
Gpatch8 A T 11: 102,399,053 (GRCm39) probably null Het
Gucy2g G A 19: 55,203,548 (GRCm39) A750V probably damaging Het
Hephl1 T C 9: 14,988,150 (GRCm39) T653A possibly damaging Het
Herc3 T A 6: 58,851,263 (GRCm39) M504K probably damaging Het
Hmcn2 A G 2: 31,350,333 (GRCm39) T5077A probably benign Het
Ifitm3 T C 7: 140,590,554 (GRCm39) N2S probably benign Het
Ighe T C 12: 113,235,092 (GRCm39) H356R probably benign Het
Ighv10-3 T A 12: 114,487,125 (GRCm39) M99L probably benign Het
Izumo4 C A 10: 80,538,639 (GRCm39) C30* probably null Het
Jag1 A T 2: 136,937,464 (GRCm39) H303Q possibly damaging Het
Kif24 T C 4: 41,395,373 (GRCm39) E500G probably benign Het
Kng1 A T 16: 22,897,842 (GRCm39) D414V probably damaging Het
Loxhd1 A C 18: 77,451,308 (GRCm39) D410A probably damaging Het
Ltn1 T C 16: 87,212,899 (GRCm39) K554R possibly damaging Het
Ly75 A G 2: 60,133,985 (GRCm39) C1547R probably damaging Het
Ms4a6d A T 19: 11,564,500 (GRCm39) S124T possibly damaging Het
Mtcl3 A G 10: 29,072,766 (GRCm39) D686G probably benign Het
Mtfr2 A G 10: 20,233,448 (GRCm39) D339G probably damaging Het
Myh10 T A 11: 68,692,434 (GRCm39) L1369Q probably damaging Het
Myh11 A T 16: 14,025,872 (GRCm39) V1366D possibly damaging Het
Nadsyn1 A G 7: 143,357,023 (GRCm39) V491A possibly damaging Het
Nav3 T C 10: 109,688,966 (GRCm39) N437S probably benign Het
Ncf1 A G 5: 134,250,659 (GRCm39) L373P probably damaging Het
Neb A T 2: 52,079,873 (GRCm39) I85N probably damaging Het
Nktr A G 9: 121,577,659 (GRCm39) K576E probably benign Het
Nmur2 T A 11: 55,931,040 (GRCm39) I224F probably damaging Het
Oas3 A G 5: 120,895,055 (GRCm39) F978S probably damaging Het
Or10ag53 C T 2: 87,082,827 (GRCm39) P182L probably benign Het
Or10ak9 T C 4: 118,726,772 (GRCm39) S264P probably damaging Het
Or2r3 T A 6: 42,448,186 (GRCm39) I309F probably benign Het
Or2t48 A T 11: 58,420,308 (GRCm39) M168K probably damaging Het
Or5p60 T C 7: 107,724,375 (GRCm39) T32A probably benign Het
Pcyox1 A T 6: 86,369,336 (GRCm39) probably null Het
Pdcd7 G A 9: 65,265,974 (GRCm39) W477* probably null Het
Pitpnm1 T C 19: 4,153,435 (GRCm39) F197S probably damaging Het
Plce1 C A 19: 38,748,535 (GRCm39) N1755K probably damaging Het
Pnpla7 C A 2: 24,931,031 (GRCm39) P882Q probably damaging Het
Pold2 A G 11: 5,826,760 (GRCm39) L58P probably damaging Het
Pomt1 C G 2: 32,134,311 (GRCm39) Y277* probably null Het
Pou4f2 A G 8: 79,162,958 (GRCm39) Y26H unknown Het
Pphln1-ps1 T G 16: 13,495,622 (GRCm39) N240K probably benign Het
Ppm1e A T 11: 87,249,377 (GRCm39) L118Q possibly damaging Het
Pramel34 C T 5: 93,785,607 (GRCm39) M224I possibly damaging Het
Prdx2 T A 8: 85,698,302 (GRCm39) Y164* probably null Het
Prkra T G 2: 76,469,622 (GRCm39) T146P probably damaging Het
Prpf8 A G 11: 75,386,625 (GRCm39) D1038G probably damaging Het
Rab4a A T 8: 124,554,113 (GRCm39) I16L probably benign Het
Rai2 A G X: 160,561,636 (GRCm39) N363S probably benign Het
Ranbp17 A T 11: 33,169,241 (GRCm39) V991D possibly damaging Het
Rimbp2 G A 5: 128,865,656 (GRCm39) T557M probably benign Het
Rmi1 G A 13: 58,557,280 (GRCm39) G510R probably damaging Het
Sdad1 A G 5: 92,434,684 (GRCm39) *687Q probably null Het
Sema6d T C 2: 124,506,166 (GRCm39) L720P probably damaging Het
Setx T G 2: 29,024,045 (GRCm39) probably null Het
Sgsm3 T C 15: 80,892,200 (GRCm39) V256A probably benign Het
Slc28a2b C A 2: 122,353,259 (GRCm39) L480I probably benign Het
Sppl2c T A 11: 104,078,127 (GRCm39) I309K possibly damaging Het
Stard9 A G 2: 120,531,111 (GRCm39) E2456G probably damaging Het
Strn3 C G 12: 51,694,803 (GRCm39) R320P probably damaging Het
Supv3l1 A T 10: 62,266,375 (GRCm39) N600K possibly damaging Het
Syne2 T A 12: 76,146,112 (GRCm39) S6377T possibly damaging Het
Tas2r123 A T 6: 132,824,190 (GRCm39) H29L probably benign Het
Tbl3 C T 17: 24,924,944 (GRCm39) V52M possibly damaging Het
Tbp A G 17: 15,727,609 (GRCm39) I145V probably benign Het
Tcf20 A T 15: 82,739,910 (GRCm39) S514T possibly damaging Het
Tgm4 A G 9: 122,885,559 (GRCm39) Y367C probably damaging Het
Tle1 C T 4: 72,060,081 (GRCm39) V258M probably damaging Het
Tln1 C T 4: 43,540,661 (GRCm39) V1447I probably benign Het
Tnfrsf11b C T 15: 54,141,622 (GRCm39) A8T probably benign Het
Trim80 A T 11: 115,338,843 (GRCm39) T558S probably benign Het
Trmt6 C A 2: 132,650,703 (GRCm39) A302S probably benign Het
Tsen15 C T 1: 152,259,131 (GRCm39) V76I probably damaging Het
Ttc17 A T 2: 94,133,985 (GRCm39) W1067R probably damaging Het
Ucn3 A T 13: 3,991,474 (GRCm39) F59L probably benign Het
Ulk3 T A 9: 57,498,023 (GRCm39) I108N possibly damaging Het
Vmn2r94 A C 17: 18,464,728 (GRCm39) Y521D probably damaging Het
Vps45 T C 3: 95,965,086 (GRCm39) M1V probably null Het
Vta1 C A 10: 14,581,143 (GRCm39) L21F probably damaging Het
Zdhhc21 C T 4: 82,765,929 (GRCm39) G2D probably damaging Het
Zfp90 C T 8: 107,152,000 (GRCm39) T571M probably damaging Het
Zswim8 A T 14: 20,768,939 (GRCm39) N1119I possibly damaging Het
Other mutations in Zfp169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Zfp169 APN 13 48,644,239 (GRCm39) unclassified probably benign
IGL03329:Zfp169 APN 13 48,644,270 (GRCm39) unclassified probably benign
IGL03382:Zfp169 APN 13 48,644,639 (GRCm39) unclassified probably benign
IGL03394:Zfp169 APN 13 48,643,400 (GRCm39) missense possibly damaging 0.93
BB010:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
BB020:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
R0571:Zfp169 UTSW 13 48,643,166 (GRCm39) missense possibly damaging 0.71
R1714:Zfp169 UTSW 13 48,652,330 (GRCm39) missense probably benign 0.35
R1784:Zfp169 UTSW 13 48,643,295 (GRCm39) missense possibly damaging 0.61
R3108:Zfp169 UTSW 13 48,643,472 (GRCm39) missense possibly damaging 0.86
R3689:Zfp169 UTSW 13 48,660,377 (GRCm39) splice site probably benign
R4444:Zfp169 UTSW 13 48,643,813 (GRCm39) missense possibly damaging 0.94
R4665:Zfp169 UTSW 13 48,644,339 (GRCm39) unclassified probably benign
R4719:Zfp169 UTSW 13 48,643,634 (GRCm39) missense probably benign 0.06
R4745:Zfp169 UTSW 13 48,643,708 (GRCm39) missense possibly damaging 0.71
R5384:Zfp169 UTSW 13 48,643,751 (GRCm39) missense possibly damaging 0.61
R5979:Zfp169 UTSW 13 48,644,516 (GRCm39) unclassified probably benign
R6053:Zfp169 UTSW 13 48,652,334 (GRCm39) missense probably damaging 1.00
R6823:Zfp169 UTSW 13 48,644,472 (GRCm39) unclassified probably benign
R7084:Zfp169 UTSW 13 48,652,339 (GRCm39) missense probably benign 0.10
R7679:Zfp169 UTSW 13 48,651,859 (GRCm39) missense probably damaging 0.99
R7933:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
R8298:Zfp169 UTSW 13 48,651,853 (GRCm39) nonsense probably null
R8322:Zfp169 UTSW 13 48,644,575 (GRCm39) missense unknown
R9047:Zfp169 UTSW 13 48,652,292 (GRCm39) missense probably damaging 1.00
R9124:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9126:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9131:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9132:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGCTTTACAAACGCACGC -3'
(R):5'- GTCACACACTCTGGTGAGAAAC -3'

Sequencing Primer
(F):5'- GCACGCCCACACTCAGG -3'
(R):5'- TGAGAAACCTCACGTTTGCC -3'
Posted On 2016-08-04