Incidental Mutation 'R0491:Slc25a54'
ID42455
Institutional Source Beutler Lab
Gene Symbol Slc25a54
Ensembl Gene ENSMUSG00000027880
Gene Namesolute carrier family 25, member 54
Synonyms4930443G12Rik, SCaMC-1like
MMRRC Submission 038689-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R0491 (G1)
Quality Score216
Status Validated
Chromosome3
Chromosomal Location109080469-109116687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109102796 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 204 (A204T)
Ref Sequence ENSEMBL: ENSMUSP00000029478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029478] [ENSMUST00000159926]
Predicted Effect probably damaging
Transcript: ENSMUST00000029478
AA Change: A204T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029478
Gene: ENSMUSG00000027880
AA Change: A204T

DomainStartEndE-ValueType
EFh 23 51 4.28e0 SMART
EFh 59 87 3.82e0 SMART
EFh 90 118 4.12e-3 SMART
EFh 126 154 3.44e1 SMART
Pfam:Mito_carr 191 283 3.7e-25 PFAM
Pfam:Mito_carr 284 376 7.2e-24 PFAM
Pfam:Mito_carr 383 472 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159926
SMART Domains Protein: ENSMUSP00000124484
Gene: ENSMUSG00000027880

DomainStartEndE-ValueType
Blast:EFh 1 21 6e-9 BLAST
Pfam:Mito_carr 57 150 3.2e-26 PFAM
Pfam:Mito_carr 151 243 3.6e-25 PFAM
Pfam:Mito_carr 249 339 1.5e-16 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,182,243 S356T probably damaging Het
Abca13 T C 11: 9,298,235 F2661L probably benign Het
Acadsb A G 7: 131,430,107 D224G probably benign Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts2 A G 11: 50,776,630 D465G probably damaging Het
Akap9 A T 5: 3,972,851 probably benign Het
Alms1 A G 6: 85,702,600 T3240A probably damaging Het
Ap3d1 A G 10: 80,719,241 W417R probably damaging Het
Arfgef1 C A 1: 10,179,987 probably benign Het
Atf6 A G 1: 170,787,344 probably null Het
Cacna1s T A 1: 136,089,008 probably benign Het
Clcn1 T C 6: 42,310,581 F740L probably benign Het
Clec12a T A 6: 129,364,053 D265E probably benign Het
Clic3 T A 2: 25,457,785 probably benign Het
Cntnap3 T G 13: 64,762,045 T749P probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Crxos T A 7: 15,898,535 S89T probably benign Het
Cxcr1 G T 1: 74,192,309 P185T possibly damaging Het
Cyp20a1 T A 1: 60,371,327 N262K possibly damaging Het
Dpy19l2 T C 9: 24,696,028 R46G probably benign Het
Dpysl2 A T 14: 66,807,962 L454Q probably damaging Het
Dvl3 C T 16: 20,527,423 probably benign Het
Eppin T A 2: 164,589,412 E98V possibly damaging Het
Fancm A T 12: 65,106,061 H1097L probably benign Het
Fkbp4 A G 6: 128,435,742 I75T probably damaging Het
Fmn2 A G 1: 174,581,959 H586R unknown Het
Gm973 C T 1: 59,558,234 probably benign Het
Haus6 A C 4: 86,602,846 V185G possibly damaging Het
Herc2 T A 7: 56,122,366 C1098S possibly damaging Het
Hic1 C A 11: 75,166,310 L584F possibly damaging Het
Itgb1bp1 C A 12: 21,276,895 probably benign Het
Kbtbd2 G A 6: 56,780,389 R121* probably null Het
Lgr4 C T 2: 110,007,281 probably benign Het
Lrrc55 T C 2: 85,191,920 E309G probably damaging Het
Mertk T C 2: 128,793,107 probably null Het
Micu3 A G 8: 40,366,253 probably benign Het
Mmp11 G A 10: 75,926,758 A287V probably benign Het
Mpzl2 A G 9: 45,042,741 Y47C probably damaging Het
Muc5b A C 7: 141,862,015 R2899S probably benign Het
Myo1b A G 1: 51,755,698 Y1078H probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Ncapd3 T G 9: 27,057,883 V611G probably damaging Het
Ntpcr C T 8: 125,737,354 R73* probably null Het
Olfr1225 A T 2: 89,170,360 V284E probably benign Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Osbp2 A G 11: 3,714,709 F88S probably damaging Het
Pkn3 A T 2: 30,089,877 T711S probably damaging Het
Plekhm1 T C 11: 103,394,776 K278E probably benign Het
Ppp1r36 A G 12: 76,439,291 T408A probably benign Het
Prss41 T C 17: 23,842,503 T105A possibly damaging Het
Psme1 G T 14: 55,579,921 probably benign Het
Ptprq A T 10: 107,608,175 Y1523N probably damaging Het
Ric8b A G 10: 84,992,222 D470G probably damaging Het
Scarb1 A G 5: 125,298,731 probably benign Het
Spink10 T C 18: 62,659,965 C67R probably damaging Het
St5 T A 7: 109,557,204 Q113L probably benign Het
Tmtc1 A T 6: 148,412,640 probably null Het
Tprkb A G 6: 85,924,464 D28G probably benign Het
Ttll13 A G 7: 80,260,350 H747R probably benign Het
Usp24 A G 4: 106,402,105 S1608G probably benign Het
Utp20 A T 10: 88,760,912 F2115L probably damaging Het
Vmn1r200 A T 13: 22,395,191 I46L probably benign Het
Zdhhc8 A T 16: 18,228,390 M103K probably damaging Het
Zfp595 C T 13: 67,317,305 G298E probably damaging Het
Zfp738 T G 13: 67,670,021 H617P possibly damaging Het
Zfp9 A T 6: 118,465,202 H166Q probably damaging Het
Zp3r C A 1: 130,618,334 D80Y probably damaging Het
Other mutations in Slc25a54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Slc25a54 APN 3 109112860 missense possibly damaging 0.76
IGL02635:Slc25a54 APN 3 109112817 missense possibly damaging 0.71
IGL02944:Slc25a54 APN 3 109080615 missense probably benign 0.14
IGL02987:Slc25a54 APN 3 109116337 missense probably benign
IGL03346:Slc25a54 APN 3 109085730 intron probably benign
R0520:Slc25a54 UTSW 3 109107230 splice site probably benign
R0645:Slc25a54 UTSW 3 109112165 missense possibly damaging 0.70
R1803:Slc25a54 UTSW 3 109102697 missense probably benign
R1869:Slc25a54 UTSW 3 109080616 nonsense probably null
R1870:Slc25a54 UTSW 3 109080616 nonsense probably null
R3024:Slc25a54 UTSW 3 109080666 missense probably damaging 1.00
R3763:Slc25a54 UTSW 3 109112054 missense probably damaging 1.00
R3930:Slc25a54 UTSW 3 109116504 missense probably benign 0.03
R3941:Slc25a54 UTSW 3 109112163 missense probably damaging 1.00
R4346:Slc25a54 UTSW 3 109102739 missense possibly damaging 0.52
R4347:Slc25a54 UTSW 3 109102739 missense possibly damaging 0.52
R4445:Slc25a54 UTSW 3 109098668 missense probably benign 0.00
R4735:Slc25a54 UTSW 3 109098607 missense probably damaging 0.96
R4914:Slc25a54 UTSW 3 109111079 missense probably benign 0.34
R4960:Slc25a54 UTSW 3 109112816 missense possibly damaging 0.95
R5052:Slc25a54 UTSW 3 109102700 missense probably benign 0.03
R5106:Slc25a54 UTSW 3 109112864 missense probably benign 0.02
R5806:Slc25a54 UTSW 3 109080578 missense probably benign
R5936:Slc25a54 UTSW 3 109098638 missense possibly damaging 0.88
R6511:Slc25a54 UTSW 3 109094256 missense possibly damaging 0.92
R6532:Slc25a54 UTSW 3 109112052 missense probably damaging 1.00
R6879:Slc25a54 UTSW 3 109112834 missense possibly damaging 0.94
R7139:Slc25a54 UTSW 3 109098589 missense probably damaging 1.00
R7179:Slc25a54 UTSW 3 109107257 missense probably benign 0.00
R7282:Slc25a54 UTSW 3 109116501 nonsense probably null
R7336:Slc25a54 UTSW 3 109116435 missense probably benign 0.00
R7355:Slc25a54 UTSW 3 109102769 missense probably damaging 1.00
R7713:Slc25a54 UTSW 3 109102817 missense probably damaging 0.99
R8061:Slc25a54 UTSW 3 109111045 missense probably damaging 1.00
Z1176:Slc25a54 UTSW 3 109112118 frame shift probably null
Z1177:Slc25a54 UTSW 3 109102797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACTCCTTCCTCAGGTACTGTGTG -3'
(R):5'- TCTGCCAGGCACTTAAAATCAACGTTA -3'

Sequencing Primer
(F):5'- ACTGTGTGGCAGGCATC -3'
(R):5'- ACGTTAAACTTATCAAGGACTCTTC -3'
Posted On2013-05-23