Incidental Mutation 'R5288:Plce1'
ID424561
Institutional Source Beutler Lab
Gene Symbol Plce1
Ensembl Gene ENSMUSG00000024998
Gene Namephospholipase C, epsilon 1
Synonyms4933403A21Rik, PLCepsilon
MMRRC Submission 042842-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R5288 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location38481109-38785030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 38760091 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1755 (N1755K)
Ref Sequence ENSEMBL: ENSMUSP00000138330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481]
Predicted Effect probably damaging
Transcript: ENSMUST00000169713
AA Change: N1741K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: N1741K

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 7.6e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182267
AA Change: N1755K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: N1755K

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 5.9e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1552 1581 N/A INTRINSIC
SCOP:d1qasa3 1648 1676 1e-3 SMART
low complexity region 1680 1694 N/A INTRINSIC
PLCYc 1724 1840 4.28e-46 SMART
C2 1864 1962 3.7e-10 SMART
PDB:2BYE|A 2000 2108 6e-47 PDB
RA 2129 2232 1.12e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182481
AA Change: N1741K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: N1741K

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 8e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182589
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T G 16: 13,677,758 N240K probably benign Het
Abcc12 A T 8: 86,566,539 Y7N probably damaging Het
Adcy1 A C 11: 7,161,351 I881L probably benign Het
Aftph T C 11: 20,726,994 D205G probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
C87414 C T 5: 93,637,748 M224I possibly damaging Het
Ccdc88a T G 11: 29,498,416 N1465K possibly damaging Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cep70 T A 9: 99,281,075 L325Q probably damaging Het
Cfap46 A G 7: 139,613,507 probably null Het
Cftr C T 6: 18,226,129 Q359* probably null Het
Chrne A T 11: 70,615,087 N457K possibly damaging Het
Cntn2 A G 1: 132,523,677 I438T probably benign Het
Cntn4 T C 6: 106,181,804 L10P possibly damaging Het
Copg1 G T 6: 87,890,207 M87I possibly damaging Het
Cyfip1 A T 7: 55,925,135 M1045L possibly damaging Het
Cyp2c29 C T 19: 39,330,372 P432L probably damaging Het
Dcaf11 T A 14: 55,563,376 D96E probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnhd1 G A 7: 105,714,437 E4069K possibly damaging Het
Dpy19l4 T A 4: 11,289,721 N330I probably damaging Het
Dpy19l4 G T 4: 11,304,014 A132D probably damaging Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp11 T C 6: 85,947,605 *322W probably null Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Eml3 G A 19: 8,939,274 G720S probably damaging Het
F11 A G 8: 45,246,796 S418P probably damaging Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fat2 G A 11: 55,267,656 T3412I probably benign Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Gm10134 T A 2: 28,506,360 probably benign Het
Gm11787 T C 4: 3,511,795 noncoding transcript Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hephl1 T C 9: 15,076,854 T653A possibly damaging Het
Herc3 T A 6: 58,874,278 M504K probably damaging Het
Hmcn2 A G 2: 31,460,321 T5077A probably benign Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Ighe T C 12: 113,271,472 H356R probably benign Het
Ighv10-3 T A 12: 114,523,505 M99L probably benign Het
Izumo4 C A 10: 80,702,805 C30* probably null Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kif24 T C 4: 41,395,373 E500G probably benign Het
Kng1 A T 16: 23,079,092 D414V probably damaging Het
Loxhd1 A C 18: 77,363,612 D410A probably damaging Het
Ltn1 T C 16: 87,416,011 K554R possibly damaging Het
Ly75 A G 2: 60,303,641 C1547R probably damaging Het
Ms4a6d A T 19: 11,587,136 S124T possibly damaging Het
Mtfr2 A G 10: 20,357,702 D339G probably damaging Het
Myh10 T A 11: 68,801,608 L1369Q probably damaging Het
Myh11 A T 16: 14,208,008 V1366D possibly damaging Het
Nadsyn1 A G 7: 143,803,286 V491A possibly damaging Het
Nav3 T C 10: 109,853,105 N437S probably benign Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Neb A T 2: 52,189,861 I85N probably damaging Het
Nktr A G 9: 121,748,593 K576E probably benign Het
Nmur2 T A 11: 56,040,214 I224F probably damaging Het
Oas3 A G 5: 120,756,990 F978S probably damaging Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1331 T C 4: 118,869,575 S264P probably damaging Het
Olfr330 A T 11: 58,529,482 M168K probably damaging Het
Olfr457 T A 6: 42,471,252 I309F probably benign Het
Olfr484 T C 7: 108,125,168 T32A probably benign Het
Pcyox1 A T 6: 86,392,354 probably null Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pitpnm1 T C 19: 4,103,435 F197S probably damaging Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Pomt1 C G 2: 32,244,299 Y277* probably null Het
Pou4f2 A G 8: 78,436,329 Y26H unknown Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Prdx2 T A 8: 84,971,673 Y164* probably null Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Rab4a A T 8: 123,827,374 I16L probably benign Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Rimbp2 G A 5: 128,788,592 T557M probably benign Het
Rmi1 G A 13: 58,409,466 G510R probably damaging Het
Sdad1 A G 5: 92,286,825 *687Q probably null Het
Sema6d T C 2: 124,664,246 L720P probably damaging Het
Setx T G 2: 29,134,033 probably null Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Strn3 C G 12: 51,648,020 R320P probably damaging Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Syne2 T A 12: 76,099,338 S6377T possibly damaging Het
Tas2r123 A T 6: 132,847,227 H29L probably benign Het
Tbl3 C T 17: 24,705,970 V52M possibly damaging Het
Tbp A G 17: 15,507,347 I145V probably benign Het
Tcf20 A T 15: 82,855,709 S514T possibly damaging Het
Tgm4 A G 9: 123,056,494 Y367C probably damaging Het
Tle1 C T 4: 72,141,844 V258M probably damaging Het
Tln1 C T 4: 43,540,661 V1447I probably benign Het
Tnfrsf11b C T 15: 54,278,226 A8T probably benign Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Tsen15 C T 1: 152,383,380 V76I probably damaging Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Ucn3 A T 13: 3,941,474 F59L probably benign Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vmn2r94 A C 17: 18,244,466 Y521D probably damaging Het
Vps45 T C 3: 96,057,774 M1V probably null Het
Vta1 C A 10: 14,705,399 L21F probably damaging Het
Zdhhc21 C T 4: 82,847,692 G2D probably damaging Het
Zfp169 A T 13: 48,490,275 C459S possibly damaging Het
Zfp90 C T 8: 106,425,368 T571M probably damaging Het
Zswim8 A T 14: 20,718,871 N1119I possibly damaging Het
Other mutations in Plce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plce1 APN 19 38745788 missense probably damaging 0.99
IGL00336:Plce1 APN 19 38651906 missense probably damaging 1.00
IGL00430:Plce1 APN 19 38725017 missense probably damaging 1.00
IGL00466:Plce1 APN 19 38721029 missense probably damaging 0.99
IGL00477:Plce1 APN 19 38525132 missense probably benign 0.39
IGL00839:Plce1 APN 19 38698562 missense probably damaging 1.00
IGL01292:Plce1 APN 19 38651785 splice site probably benign
IGL01665:Plce1 APN 19 38524887 missense probably benign 0.01
IGL01826:Plce1 APN 19 38739238 splice site probably benign
IGL01833:Plce1 APN 19 38720981 missense probably damaging 1.00
IGL02201:Plce1 APN 19 38769446 splice site probably benign
IGL02276:Plce1 APN 19 38524757 missense probably benign 0.05
IGL02477:Plce1 APN 19 38719553 splice site probably benign
IGL02746:Plce1 APN 19 38698472 missense probably damaging 1.00
Angel_food UTSW 19 38727013 splice site probably benign
Heavenly UTSW 19 38777989 missense probably damaging 1.00
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0064:Plce1 UTSW 19 38780784 critical splice donor site probably null
R0116:Plce1 UTSW 19 38721821 missense probably benign
R0138:Plce1 UTSW 19 38524419 missense possibly damaging 0.49
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0504:Plce1 UTSW 19 38778021 splice site probably benign
R0506:Plce1 UTSW 19 38760138 missense probably benign 0.04
R0578:Plce1 UTSW 19 38777939 missense probably damaging 1.00
R0645:Plce1 UTSW 19 38777989 missense probably damaging 1.00
R0730:Plce1 UTSW 19 38716691 missense probably damaging 0.98
R0920:Plce1 UTSW 19 38736521 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38702013 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38767226 missense probably damaging 1.00
R1484:Plce1 UTSW 19 38705339 nonsense probably null
R1488:Plce1 UTSW 19 38716803 missense possibly damaging 0.92
R1598:Plce1 UTSW 19 38720996 missense probably damaging 1.00
R1624:Plce1 UTSW 19 38724775 missense probably damaging 1.00
R1732:Plce1 UTSW 19 38716838 missense possibly damaging 0.56
R1778:Plce1 UTSW 19 38780790 splice site probably benign
R1797:Plce1 UTSW 19 38758948 critical splice donor site probably null
R1872:Plce1 UTSW 19 38760077 missense probably damaging 1.00
R1876:Plce1 UTSW 19 38780623 missense probably damaging 1.00
R1991:Plce1 UTSW 19 38777924 missense probably damaging 1.00
R2080:Plce1 UTSW 19 38727013 splice site probably benign
R2103:Plce1 UTSW 19 38777924 missense probably damaging 1.00
R2376:Plce1 UTSW 19 38777986 missense probably benign 0.02
R2471:Plce1 UTSW 19 38779926 missense probably damaging 1.00
R2511:Plce1 UTSW 19 38760054 missense probably damaging 1.00
R2842:Plce1 UTSW 19 38524283 missense probably damaging 1.00
R3037:Plce1 UTSW 19 38777884 missense probably damaging 0.98
R3104:Plce1 UTSW 19 38620519 missense probably benign 0.00
R3700:Plce1 UTSW 19 38705337 missense probably damaging 1.00
R3750:Plce1 UTSW 19 38777899 missense probably benign
R3753:Plce1 UTSW 19 38651834 missense probably benign 0.09
R4027:Plce1 UTSW 19 38524265 missense probably damaging 1.00
R4057:Plce1 UTSW 19 38760119 missense probably damaging 1.00
R4376:Plce1 UTSW 19 38705447 critical splice donor site probably null
R4433:Plce1 UTSW 19 38767301 missense probably damaging 1.00
R4520:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4521:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4522:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4524:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4650:Plce1 UTSW 19 38524644 missense probably benign 0.30
R4673:Plce1 UTSW 19 38749396 missense possibly damaging 0.51
R4701:Plce1 UTSW 19 38725007 missense probably benign 0.33
R4828:Plce1 UTSW 19 38769499 missense probably damaging 1.00
R5103:Plce1 UTSW 19 38767215 missense probably damaging 1.00
R5112:Plce1 UTSW 19 38651833 missense probably benign 0.00
R5236:Plce1 UTSW 19 38770347 missense probably benign 0.11
R5268:Plce1 UTSW 19 38758835 missense possibly damaging 0.71
R5384:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5386:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5448:Plce1 UTSW 19 38779917 missense probably damaging 1.00
R5452:Plce1 UTSW 19 38620482 missense probably benign 0.01
R6004:Plce1 UTSW 19 38721871 missense probably damaging 1.00
R6062:Plce1 UTSW 19 38524751 missense probably benign
R6147:Plce1 UTSW 19 38702037 missense probably damaging 1.00
R6247:Plce1 UTSW 19 38745845 missense probably damaging 1.00
R6278:Plce1 UTSW 19 38725051 splice site probably null
R6306:Plce1 UTSW 19 38769465 missense probably damaging 1.00
R6317:Plce1 UTSW 19 38524530 nonsense probably null
R6437:Plce1 UTSW 19 38525132 missense probably benign 0.39
R6522:Plce1 UTSW 19 38748521 splice site probably null
R7034:Plce1 UTSW 19 38739357 missense probably damaging 1.00
R7036:Plce1 UTSW 19 38739357 missense probably damaging 1.00
R7037:Plce1 UTSW 19 38702017 missense probably damaging 1.00
R7069:Plce1 UTSW 19 38758940 missense probably damaging 1.00
R7180:Plce1 UTSW 19 38779785 missense probably damaging 1.00
R7189:Plce1 UTSW 19 38760137 missense probably damaging 0.97
R7227:Plce1 UTSW 19 38726902 missense probably benign 0.00
R7253:Plce1 UTSW 19 38698508 missense probably damaging 1.00
R7278:Plce1 UTSW 19 38779896 missense possibly damaging 0.58
R7287:Plce1 UTSW 19 38701903 missense probably benign 0.02
R7422:Plce1 UTSW 19 38651885 missense probably damaging 1.00
R7557:Plce1 UTSW 19 38765404 missense probably benign 0.30
R7607:Plce1 UTSW 19 38524752 missense probably benign
R7615:Plce1 UTSW 19 38524665 missense probably benign 0.18
R7653:Plce1 UTSW 19 38749319 missense probably benign 0.20
R7685:Plce1 UTSW 19 38748433 missense probably benign 0.00
R7716:Plce1 UTSW 19 38716851 missense probably benign
R7744:Plce1 UTSW 19 38620455 missense possibly damaging 0.93
R7790:Plce1 UTSW 19 38780696 missense probably damaging 0.97
R7921:Plce1 UTSW 19 38620553 missense probably benign 0.03
R8070:Plce1 UTSW 19 38701839 missense probably damaging 0.99
R8087:Plce1 UTSW 19 38736521 missense probably damaging 1.00
R8116:Plce1 UTSW 19 38524818 missense probably benign 0.32
R8178:Plce1 UTSW 19 38772979 missense possibly damaging 0.93
R8321:Plce1 UTSW 19 38651936 missense probably benign 0.00
R8416:Plce1 UTSW 19 38772997 missense possibly damaging 0.77
R8544:Plce1 UTSW 19 38524459 missense probably benign 0.00
RF018:Plce1 UTSW 19 38717207 missense probably damaging 0.99
X0022:Plce1 UTSW 19 38726999 missense probably damaging 1.00
X0065:Plce1 UTSW 19 38777914 missense possibly damaging 0.48
Z1176:Plce1 UTSW 19 38701894 missense probably damaging 1.00
Z1176:Plce1 UTSW 19 38724980 nonsense probably null
Z1176:Plce1 UTSW 19 38769460 missense probably damaging 1.00
Z1177:Plce1 UTSW 19 38651842 missense probably null 0.48
Predicted Primers PCR Primer
(F):5'- CTGATGTGCAGCTGAGAGTG -3'
(R):5'- ACTGCATTTACTGTTGCACAAG -3'

Sequencing Primer
(F):5'- CAGCTGAGAGTGATCTTTCAAGACAC -3'
(R):5'- CTGCATTTACTGTTGCACAAGATAGG -3'
Posted On2016-08-04