Incidental Mutation 'R5289:Wdr62'
ID424594
Institutional Source Beutler Lab
Gene Symbol Wdr62
Ensembl Gene ENSMUSG00000037020
Gene NameWD repeat domain 62
Synonyms2310038K02Rik
MMRRC Submission 042872-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5289 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30240138-30280419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30267875 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 318 (V318G)
Ref Sequence ENSEMBL: ENSMUSP00000103825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108190] [ENSMUST00000145027]
Predicted Effect probably damaging
Transcript: ENSMUST00000108190
AA Change: V318G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103825
Gene: ENSMUSG00000037020
AA Change: V318G

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
low complexity region 1302 1313 N/A INTRINSIC
low complexity region 1477 1497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118272
Predicted Effect probably damaging
Transcript: ENSMUST00000145027
AA Change: V318G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116772
Gene: ENSMUSG00000037020
AA Change: V318G

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice for a hypomorphic allele exhibit reduced brain size due to decreased neural progenitor cells. Cells show spindle instability, spindle assembly checkpoint activation, mitotic arrest and cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 37,000,109 Q3126K probably damaging Het
Adgrv1 A G 13: 81,521,084 V1731A probably benign Het
Ahcyl1 A G 3: 107,669,890 probably null Het
Aox1 T A 1: 58,092,558 M1042K probably damaging Het
Atp10d C A 5: 72,255,123 Q590K probably benign Het
Atp8b1 G T 18: 64,546,087 N774K possibly damaging Het
Atrnl1 C T 19: 57,657,082 T458M probably damaging Het
BC005561 G A 5: 104,519,657 V682I probably benign Het
Cnr1 T A 4: 33,943,910 C99* probably null Het
Cnr2 A G 4: 135,917,007 Y132C probably damaging Het
Commd9 C T 2: 101,898,894 A115V probably benign Het
Diaph3 A G 14: 86,981,678 F426S probably damaging Het
Diras1 G A 10: 81,022,244 Q58* probably null Het
Dpy19l2 A G 9: 24,695,997 L56P probably benign Het
Dsc1 A T 18: 20,101,853 V248D possibly damaging Het
Frem3 A G 8: 80,612,319 M414V probably benign Het
Frmd4b G T 6: 97,302,348 probably null Het
Gabarapl2 T C 8: 111,942,595 W62R probably damaging Het
Glt1d1 A G 5: 127,644,356 R36G probably benign Het
Grb10 T C 11: 11,944,924 silent Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc A G 2: 34,996,014 probably null Het
Hgd A G 16: 37,628,551 E379G possibly damaging Het
Ifi30 A T 8: 70,766,601 probably benign Het
Iqgap1 T C 7: 80,738,724 I842V possibly damaging Het
Iqsec3 T A 6: 121,386,700 probably null Het
Kalrn A G 16: 34,252,341 S724P possibly damaging Het
Lama2 C A 10: 27,212,073 G903* probably null Het
Lrrc10 T C 10: 117,045,487 V22A probably benign Het
Lzts3 T C 2: 130,636,101 E245G probably benign Het
Man2a1 A G 17: 64,651,227 T246A probably damaging Het
Mfsd13a A G 19: 46,368,280 E240G probably benign Het
Mtor T C 4: 148,466,092 I735T possibly damaging Het
Naa15 A T 3: 51,455,894 H333L probably damaging Het
Nes C A 3: 87,978,418 T1284K probably damaging Het
Nexn T G 3: 152,248,072 H173P probably benign Het
Nid2 T C 14: 19,805,311 V1173A possibly damaging Het
Npepps A G 11: 97,240,927 probably null Het
Pgm2 T A 4: 99,967,069 M313K probably damaging Het
Pih1d3 A T 1: 31,223,527 I197F probably benign Het
Plag1 T A 4: 3,905,545 K48N probably damaging Het
Prok1 G C 3: 107,239,619 L11V probably benign Het
Ptpn9 T C 9: 57,060,063 probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc38a4 A T 15: 97,010,348 F171I possibly damaging Het
Sycp1 A T 3: 102,934,253 N78K possibly damaging Het
Tas2r110 T C 6: 132,868,009 M1T probably null Het
Tmem260 G A 14: 48,486,810 V182M possibly damaging Het
Tmem30a A T 9: 79,776,154 N144K probably damaging Het
Vmn2r108 A G 17: 20,471,604 L219P probably damaging Het
Vmn2r57 A G 7: 41,399,974 S784P probably damaging Het
Vwf T C 6: 125,667,510 probably benign Het
Zfp398 T A 6: 47,863,181 S115T probably benign Het
Zfp62 T A 11: 49,217,148 C689S probably damaging Het
Zmynd15 C G 11: 70,466,004 P580R unknown Het
Other mutations in Wdr62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Wdr62 APN 7 30243523 missense probably benign 0.00
IGL00428:Wdr62 APN 7 30270752 missense probably damaging 0.99
IGL00579:Wdr62 APN 7 30267895 missense probably damaging 1.00
IGL00709:Wdr62 APN 7 30242061 missense probably benign 0.05
IGL00924:Wdr62 APN 7 30265218 missense probably damaging 0.99
IGL00924:Wdr62 APN 7 30242806 missense probably damaging 1.00
IGL00956:Wdr62 APN 7 30261339 missense probably damaging 0.96
IGL01016:Wdr62 APN 7 30254251 missense probably benign 0.39
IGL01118:Wdr62 APN 7 30242781 missense probably damaging 0.96
IGL01458:Wdr62 APN 7 30241762 missense probably benign 0.08
IGL01977:Wdr62 APN 7 30258101 missense probably damaging 1.00
IGL02065:Wdr62 APN 7 30243469 missense possibly damaging 0.59
IGL02155:Wdr62 APN 7 30262643 missense probably damaging 1.00
IGL02260:Wdr62 APN 7 30270782 missense probably damaging 1.00
IGL02404:Wdr62 APN 7 30267873 missense probably damaging 1.00
IGL02491:Wdr62 APN 7 30242759 missense probably benign 0.19
IGL02556:Wdr62 APN 7 30245284 splice site probably null
IGL02739:Wdr62 APN 7 30242460 nonsense probably null
IGL03387:Wdr62 APN 7 30270774 missense possibly damaging 0.90
ivoire UTSW 7 30271620 missense probably damaging 1.00
I0000:Wdr62 UTSW 7 30245327 missense probably benign 0.03
R0304:Wdr62 UTSW 7 30242874 missense probably benign 0.20
R0371:Wdr62 UTSW 7 30242158 missense possibly damaging 0.56
R0400:Wdr62 UTSW 7 30241462 missense possibly damaging 0.81
R0621:Wdr62 UTSW 7 30254061 missense possibly damaging 0.94
R0634:Wdr62 UTSW 7 30270174 missense probably damaging 0.98
R1758:Wdr62 UTSW 7 30267903 missense probably damaging 1.00
R2205:Wdr62 UTSW 7 30258149 critical splice acceptor site probably null
R2254:Wdr62 UTSW 7 30267903 missense probably damaging 0.97
R2255:Wdr62 UTSW 7 30267903 missense probably damaging 0.97
R2566:Wdr62 UTSW 7 30273999 missense probably damaging 1.00
R2851:Wdr62 UTSW 7 30261437 missense possibly damaging 0.70
R3150:Wdr62 UTSW 7 30271670 missense possibly damaging 0.94
R4355:Wdr62 UTSW 7 30242248 missense probably damaging 1.00
R4517:Wdr62 UTSW 7 30270258 missense probably damaging 1.00
R4839:Wdr62 UTSW 7 30241465 missense probably benign 0.00
R4839:Wdr62 UTSW 7 30270686 missense probably damaging 1.00
R5193:Wdr62 UTSW 7 30265167 missense probably damaging 0.99
R5306:Wdr62 UTSW 7 30265263 missense possibly damaging 0.94
R5878:Wdr62 UTSW 7 30241347 missense probably benign
R5942:Wdr62 UTSW 7 30243079 nonsense probably null
R6051:Wdr62 UTSW 7 30261384 missense possibly damaging 0.69
R6237:Wdr62 UTSW 7 30242435 missense probably damaging 1.00
R6727:Wdr62 UTSW 7 30271620 missense probably damaging 1.00
R7158:Wdr62 UTSW 7 30270738 missense possibly damaging 0.77
R7208:Wdr62 UTSW 7 30252336 missense probably damaging 0.97
R7237:Wdr62 UTSW 7 30270444 splice site probably null
R7336:Wdr62 UTSW 7 30243917 missense probably damaging 0.98
R7559:Wdr62 UTSW 7 30270773 missense probably damaging 0.98
R7845:Wdr62 UTSW 7 30265242 missense possibly damaging 0.79
R7936:Wdr62 UTSW 7 30265159 missense probably damaging 1.00
R8002:Wdr62 UTSW 7 30252360 missense probably damaging 1.00
R8347:Wdr62 UTSW 7 30262703 missense possibly damaging 0.88
R8399:Wdr62 UTSW 7 30258061 missense probably damaging 1.00
R8954:Wdr62 UTSW 7 30254029 missense probably damaging 1.00
R9044:Wdr62 UTSW 7 30262637 missense probably benign
Z1176:Wdr62 UTSW 7 30255928 missense probably benign 0.00
Z1186:Wdr62 UTSW 7 30250759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGACTCTTAGGCACACAC -3'
(R):5'- TGTTCTGTGAATAAGTGTGGCAAC -3'

Sequencing Primer
(F):5'- CACCGATGCTCAGAGCTAAGAG -3'
(R):5'- CTCTGCCCCAAACCATGCTTC -3'
Posted On2016-08-04