Incidental Mutation 'R5289:Vmn2r57'
ID 424595
Institutional Source Beutler Lab
Gene Symbol Vmn2r57
Ensembl Gene ENSMUSG00000066537
Gene Name vomeronasal 2, receptor 57
Synonyms EG269902
MMRRC Submission 042872-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R5289 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 41049156-41098065 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41049398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 784 (S784P)
Ref Sequence ENSEMBL: ENSMUSP00000125817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000165029]
AlphaFold L7N269
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect probably damaging
Transcript: ENSMUST00000165029
AA Change: S784P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125817
Gene: ENSMUSG00000066537
AA Change: S784P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.4e-44 PFAM
Pfam:NCD3G 514 567 2.7e-23 PFAM
Pfam:7tm_3 600 835 1.8e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170929
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,669,203 (GRCm39) V1731A probably benign Het
Ahcyl1 A G 3: 107,577,206 (GRCm39) probably null Het
Aox1 T A 1: 58,131,717 (GRCm39) M1042K probably damaging Het
Atp10d C A 5: 72,412,466 (GRCm39) Q590K probably benign Het
Atp8b1 G T 18: 64,679,158 (GRCm39) N774K possibly damaging Het
Atrnl1 C T 19: 57,645,514 (GRCm39) T458M probably damaging Het
Bltp1 C A 3: 37,054,258 (GRCm39) Q3126K probably damaging Het
Cnr1 T A 4: 33,943,910 (GRCm39) C99* probably null Het
Cnr2 A G 4: 135,644,318 (GRCm39) Y132C probably damaging Het
Commd9 C T 2: 101,729,239 (GRCm39) A115V probably benign Het
Diaph3 A G 14: 87,219,114 (GRCm39) F426S probably damaging Het
Diras1 G A 10: 80,858,078 (GRCm39) Q58* probably null Het
Dnaaf6rt A T 1: 31,262,608 (GRCm39) I197F probably benign Het
Dpy19l2 A G 9: 24,607,293 (GRCm39) L56P probably benign Het
Dsc1 A T 18: 20,234,910 (GRCm39) V248D possibly damaging Het
Frem3 A G 8: 81,338,948 (GRCm39) M414V probably benign Het
Frmd4b G T 6: 97,279,309 (GRCm39) probably null Het
Gabarapl2 T C 8: 112,669,227 (GRCm39) W62R probably damaging Het
Glt1d1 A G 5: 127,721,420 (GRCm39) R36G probably benign Het
Grb10 T C 11: 11,894,924 (GRCm39) silent Het
Gtf2h3 C T 5: 124,722,360 (GRCm39) T121I probably benign Het
Hc A G 2: 34,886,026 (GRCm39) probably null Het
Hgd A G 16: 37,448,913 (GRCm39) E379G possibly damaging Het
Ifi30 A T 8: 71,219,245 (GRCm39) probably benign Het
Iqgap1 T C 7: 80,388,472 (GRCm39) I842V possibly damaging Het
Iqsec3 T A 6: 121,363,659 (GRCm39) probably null Het
Kalrn A G 16: 34,072,711 (GRCm39) S724P possibly damaging Het
Lama2 C A 10: 27,088,069 (GRCm39) G903* probably null Het
Lrrc10 T C 10: 116,881,392 (GRCm39) V22A probably benign Het
Lzts3 T C 2: 130,478,021 (GRCm39) E245G probably benign Het
Man2a1 A G 17: 64,958,222 (GRCm39) T246A probably damaging Het
Mfsd13a A G 19: 46,356,719 (GRCm39) E240G probably benign Het
Mtor T C 4: 148,550,549 (GRCm39) I735T possibly damaging Het
Naa15 A T 3: 51,363,315 (GRCm39) H333L probably damaging Het
Nes C A 3: 87,885,725 (GRCm39) T1284K probably damaging Het
Nexn T G 3: 151,953,709 (GRCm39) H173P probably benign Het
Nid2 T C 14: 19,855,379 (GRCm39) V1173A possibly damaging Het
Npepps A G 11: 97,131,753 (GRCm39) probably null Het
Pgm1 T A 4: 99,824,266 (GRCm39) M313K probably damaging Het
Plag1 T A 4: 3,905,545 (GRCm39) K48N probably damaging Het
Prok1 G C 3: 107,146,935 (GRCm39) L11V probably benign Het
Ptpn9 T C 9: 56,967,347 (GRCm39) probably null Het
Skint8 C A 4: 111,807,390 (GRCm39) L359M probably damaging Het
Slc38a4 A T 15: 96,908,229 (GRCm39) F171I possibly damaging Het
Sycp1 A T 3: 102,841,569 (GRCm39) N78K possibly damaging Het
Tas2r110 T C 6: 132,844,972 (GRCm39) M1T probably null Het
Thoc2l G A 5: 104,667,523 (GRCm39) V682I probably benign Het
Tmem260 G A 14: 48,724,267 (GRCm39) V182M possibly damaging Het
Tmem30a A T 9: 79,683,436 (GRCm39) N144K probably damaging Het
Vmn2r108 A G 17: 20,691,866 (GRCm39) L219P probably damaging Het
Vwf T C 6: 125,644,473 (GRCm39) probably benign Het
Wdr62 A C 7: 29,967,300 (GRCm39) V318G probably damaging Het
Zfp398 T A 6: 47,840,115 (GRCm39) S115T probably benign Het
Zfp62 T A 11: 49,107,975 (GRCm39) C689S probably damaging Het
Zmynd15 C G 11: 70,356,830 (GRCm39) P580R unknown Het
Other mutations in Vmn2r57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vmn2r57 APN 7 41,078,209 (GRCm39) missense probably benign
IGL01108:Vmn2r57 APN 7 41,077,008 (GRCm39) missense probably benign 0.01
IGL01112:Vmn2r57 APN 7 41,074,467 (GRCm39) missense probably damaging 1.00
IGL01516:Vmn2r57 APN 7 41,049,370 (GRCm39) missense probably damaging 1.00
IGL01880:Vmn2r57 APN 7 41,049,619 (GRCm39) missense possibly damaging 0.73
IGL02117:Vmn2r57 APN 7 41,049,874 (GRCm39) missense probably benign 0.00
IGL02500:Vmn2r57 APN 7 41,077,650 (GRCm39) missense probably benign
IGL02801:Vmn2r57 APN 7 41,098,056 (GRCm39) missense probably benign 0.13
IGL02993:Vmn2r57 APN 7 41,077,498 (GRCm39) missense probably benign 0.04
IGL02996:Vmn2r57 APN 7 41,049,165 (GRCm39) missense probably benign 0.02
R0008:Vmn2r57 UTSW 7 41,050,076 (GRCm39) missense probably damaging 1.00
R0032:Vmn2r57 UTSW 7 41,049,157 (GRCm39) splice site probably null
R0305:Vmn2r57 UTSW 7 41,076,967 (GRCm39) missense probably benign 0.00
R0469:Vmn2r57 UTSW 7 41,077,216 (GRCm39) missense possibly damaging 0.58
R0510:Vmn2r57 UTSW 7 41,077,216 (GRCm39) missense possibly damaging 0.58
R0847:Vmn2r57 UTSW 7 41,078,225 (GRCm39) missense probably benign 0.00
R1025:Vmn2r57 UTSW 7 41,077,228 (GRCm39) missense probably benign 0.24
R1081:Vmn2r57 UTSW 7 41,077,635 (GRCm39) missense possibly damaging 0.47
R1479:Vmn2r57 UTSW 7 41,077,254 (GRCm39) missense possibly damaging 0.45
R1579:Vmn2r57 UTSW 7 41,049,548 (GRCm39) missense probably benign 0.38
R1764:Vmn2r57 UTSW 7 41,050,067 (GRCm39) missense probably damaging 1.00
R1848:Vmn2r57 UTSW 7 41,077,531 (GRCm39) missense probably damaging 1.00
R2006:Vmn2r57 UTSW 7 41,098,001 (GRCm39) missense probably benign 0.00
R2197:Vmn2r57 UTSW 7 41,078,249 (GRCm39) critical splice acceptor site probably null
R2242:Vmn2r57 UTSW 7 41,077,498 (GRCm39) missense probably benign 0.00
R2394:Vmn2r57 UTSW 7 41,049,619 (GRCm39) missense possibly damaging 0.73
R3937:Vmn2r57 UTSW 7 41,077,554 (GRCm39) missense probably damaging 0.97
R4193:Vmn2r57 UTSW 7 41,077,663 (GRCm39) missense probably benign
R4423:Vmn2r57 UTSW 7 41,076,064 (GRCm39) missense probably damaging 1.00
R4865:Vmn2r57 UTSW 7 41,049,892 (GRCm39) missense probably damaging 1.00
R4947:Vmn2r57 UTSW 7 41,049,919 (GRCm39) missense probably damaging 1.00
R5042:Vmn2r57 UTSW 7 41,078,086 (GRCm39) missense probably benign 0.06
R5084:Vmn2r57 UTSW 7 41,075,974 (GRCm39) critical splice donor site probably null
R5177:Vmn2r57 UTSW 7 41,049,664 (GRCm39) missense probably benign 0.31
R5192:Vmn2r57 UTSW 7 41,077,363 (GRCm39) missense probably damaging 0.96
R5745:Vmn2r57 UTSW 7 41,097,895 (GRCm39) missense possibly damaging 0.51
R6051:Vmn2r57 UTSW 7 41,097,896 (GRCm39) missense probably benign 0.00
R6155:Vmn2r57 UTSW 7 41,078,114 (GRCm39) missense probably benign 0.14
R6248:Vmn2r57 UTSW 7 41,049,284 (GRCm39) missense probably benign
R6381:Vmn2r57 UTSW 7 41,078,242 (GRCm39) missense probably benign 0.08
R7019:Vmn2r57 UTSW 7 41,078,089 (GRCm39) missense probably damaging 1.00
R7126:Vmn2r57 UTSW 7 41,049,218 (GRCm39) missense possibly damaging 0.93
R7146:Vmn2r57 UTSW 7 41,097,895 (GRCm39) missense possibly damaging 0.51
R7215:Vmn2r57 UTSW 7 41,049,710 (GRCm39) missense probably benign 0.00
R7432:Vmn2r57 UTSW 7 41,076,148 (GRCm39) missense probably benign 0.01
R7633:Vmn2r57 UTSW 7 41,074,513 (GRCm39) missense possibly damaging 0.76
R7811:Vmn2r57 UTSW 7 41,074,439 (GRCm39) nonsense probably null
R8025:Vmn2r57 UTSW 7 41,076,183 (GRCm39) missense probably benign 0.00
R8332:Vmn2r57 UTSW 7 41,049,677 (GRCm39) missense probably benign 0.01
R8345:Vmn2r57 UTSW 7 41,076,968 (GRCm39) missense possibly damaging 0.81
R8360:Vmn2r57 UTSW 7 41,049,640 (GRCm39) missense probably damaging 1.00
R8738:Vmn2r57 UTSW 7 41,077,020 (GRCm39) missense probably benign 0.00
R8758:Vmn2r57 UTSW 7 41,078,163 (GRCm39) missense probably damaging 1.00
R8955:Vmn2r57 UTSW 7 41,049,571 (GRCm39) missense possibly damaging 0.64
R8985:Vmn2r57 UTSW 7 41,049,259 (GRCm39) missense probably benign
R9108:Vmn2r57 UTSW 7 41,078,192 (GRCm39) missense possibly damaging 0.87
R9160:Vmn2r57 UTSW 7 41,076,159 (GRCm39) missense possibly damaging 0.48
R9354:Vmn2r57 UTSW 7 41,049,663 (GRCm39) missense probably benign 0.01
R9566:Vmn2r57 UTSW 7 41,077,089 (GRCm39) missense probably benign 0.32
R9633:Vmn2r57 UTSW 7 41,076,006 (GRCm39) missense probably benign 0.00
X0026:Vmn2r57 UTSW 7 41,077,985 (GRCm39) missense possibly damaging 0.91
X0026:Vmn2r57 UTSW 7 41,077,549 (GRCm39) missense probably benign 0.03
X0065:Vmn2r57 UTSW 7 41,077,395 (GRCm39) missense probably benign 0.09
Z1176:Vmn2r57 UTSW 7 41,049,922 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCCTGATATCAAGACATGAGTTC -3'
(R):5'- ATGGCTGGCTACCTTTCCAC -3'

Sequencing Primer
(F):5'- CAAGACATGAGTTCTTATCTGGCC -3'
(R):5'- CCACCTTTTATTGATCAAAATGCTC -3'
Posted On 2016-08-04