Mutagenetix > Incidental Mutation

Incidental Mutation 'R5289:Vmn2r57'

424595

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r57

Ensembl Gene

ENSMUSG00000066537

Gene Name

vomeronasal 2, receptor 57

Synonyms

EG269902

MMRRC Submission

042872-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.127) question?

Stock #

R5289 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41399732-41448641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41399974 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 784 (S784P)

Ref Sequence

ENSEMBL: ENSMUSP00000125817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000165029]

AlphaFold

L7N269

Predicted Effect

probably benign
Transcript: ENSMUST00000094532

Predicted Effect

probably damaging
Transcript: ENSMUST00000165029
AA Change: S784P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125817
Gene: ENSMUSG00000066537
AA Change: S784P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	471	1.4e-44	PFAM
Pfam:NCD3G	514	567	2.7e-23	PFAM
Pfam:7tm_3	600	835	1.8e-52	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170929

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 37,000,109	Q3126K	probably damaging	Het
Adgrv1	A	G	13: 81,521,084	V1731A	probably benign	Het
Ahcyl1	A	G	3: 107,669,890		probably null	Het
Aox1	T	A	1: 58,092,558	M1042K	probably damaging	Het
Atp10d	C	A	5: 72,255,123	Q590K	probably benign	Het
Atp8b1	G	T	18: 64,546,087	N774K	possibly damaging	Het
Atrnl1	C	T	19: 57,657,082	T458M	probably damaging	Het
BC005561	G	A	5: 104,519,657	V682I	probably benign	Het
Cnr1	T	A	4: 33,943,910	C99*	probably null	Het
Cnr2	A	G	4: 135,917,007	Y132C	probably damaging	Het
Commd9	C	T	2: 101,898,894	A115V	probably benign	Het
Diaph3	A	G	14: 86,981,678	F426S	probably damaging	Het
Diras1	G	A	10: 81,022,244	Q58*	probably null	Het
Dpy19l2	A	G	9: 24,695,997	L56P	probably benign	Het
Dsc1	A	T	18: 20,101,853	V248D	possibly damaging	Het
Frem3	A	G	8: 80,612,319	M414V	probably benign	Het
Frmd4b	G	T	6: 97,302,348		probably null	Het
Gabarapl2	T	C	8: 111,942,595	W62R	probably damaging	Het
Glt1d1	A	G	5: 127,644,356	R36G	probably benign	Het
Grb10	T	C	11: 11,944,924		silent	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Hc	A	G	2: 34,996,014		probably null	Het
Hgd	A	G	16: 37,628,551	E379G	possibly damaging	Het
Ifi30	A	T	8: 70,766,601		probably benign	Het
Iqgap1	T	C	7: 80,738,724	I842V	possibly damaging	Het
Iqsec3	T	A	6: 121,386,700		probably null	Het
Kalrn	A	G	16: 34,252,341	S724P	possibly damaging	Het
Lama2	C	A	10: 27,212,073	G903*	probably null	Het
Lrrc10	T	C	10: 117,045,487	V22A	probably benign	Het
Lzts3	T	C	2: 130,636,101	E245G	probably benign	Het
Man2a1	A	G	17: 64,651,227	T246A	probably damaging	Het
Mfsd13a	A	G	19: 46,368,280	E240G	probably benign	Het
Mtor	T	C	4: 148,466,092	I735T	possibly damaging	Het
Naa15	A	T	3: 51,455,894	H333L	probably damaging	Het
Nes	C	A	3: 87,978,418	T1284K	probably damaging	Het
Nexn	T	G	3: 152,248,072	H173P	probably benign	Het
Nid2	T	C	14: 19,805,311	V1173A	possibly damaging	Het
Npepps	A	G	11: 97,240,927		probably null	Het
Pgm2	T	A	4: 99,967,069	M313K	probably damaging	Het
Pih1d3	A	T	1: 31,223,527	I197F	probably benign	Het
Plag1	T	A	4: 3,905,545	K48N	probably damaging	Het
Prok1	G	C	3: 107,239,619	L11V	probably benign	Het
Ptpn9	T	C	9: 57,060,063		probably null	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Slc38a4	A	T	15: 97,010,348	F171I	possibly damaging	Het
Sycp1	A	T	3: 102,934,253	N78K	possibly damaging	Het
Tas2r110	T	C	6: 132,868,009	M1T	probably null	Het
Tmem260	G	A	14: 48,486,810	V182M	possibly damaging	Het
Tmem30a	A	T	9: 79,776,154	N144K	probably damaging	Het
Vmn2r108	A	G	17: 20,471,604	L219P	probably damaging	Het
Vwf	T	C	6: 125,667,510		probably benign	Het
Wdr62	A	C	7: 30,267,875	V318G	probably damaging	Het
Zfp398	T	A	6: 47,863,181	S115T	probably benign	Het
Zfp62	T	A	11: 49,217,148	C689S	probably damaging	Het
Zmynd15	C	G	11: 70,466,004	P580R	unknown	Het

Other mutations in Vmn2r57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Vmn2r57	APN	7	41428785	missense	probably benign
IGL01108:Vmn2r57	APN	7	41427584	missense	probably benign	0.01
IGL01112:Vmn2r57	APN	7	41425043	missense	probably damaging	1.00
IGL01516:Vmn2r57	APN	7	41399946	missense	probably damaging	1.00
IGL01880:Vmn2r57	APN	7	41400195	missense	possibly damaging	0.73
IGL02117:Vmn2r57	APN	7	41400450	missense	probably benign	0.00
IGL02500:Vmn2r57	APN	7	41428226	missense	probably benign
IGL02801:Vmn2r57	APN	7	41448632	missense	probably benign	0.13
IGL02993:Vmn2r57	APN	7	41428074	missense	probably benign	0.04
IGL02996:Vmn2r57	APN	7	41399741	missense	probably benign	0.02
R0008:Vmn2r57	UTSW	7	41400652	missense	probably damaging	1.00
R0032:Vmn2r57	UTSW	7	41399733	splice site	probably null
R0305:Vmn2r57	UTSW	7	41427543	missense	probably benign	0.00
R0469:Vmn2r57	UTSW	7	41427792	missense	possibly damaging	0.58
R0510:Vmn2r57	UTSW	7	41427792	missense	possibly damaging	0.58
R0847:Vmn2r57	UTSW	7	41428801	missense	probably benign	0.00
R1025:Vmn2r57	UTSW	7	41427804	missense	probably benign	0.24
R1081:Vmn2r57	UTSW	7	41428211	missense	possibly damaging	0.47
R1479:Vmn2r57	UTSW	7	41427830	missense	possibly damaging	0.45
R1579:Vmn2r57	UTSW	7	41400124	missense	probably benign	0.38
R1764:Vmn2r57	UTSW	7	41400643	missense	probably damaging	1.00
R1848:Vmn2r57	UTSW	7	41428107	missense	probably damaging	1.00
R2006:Vmn2r57	UTSW	7	41448577	missense	probably benign	0.00
R2197:Vmn2r57	UTSW	7	41428825	critical splice acceptor site	probably null
R2242:Vmn2r57	UTSW	7	41428074	missense	probably benign	0.00
R2394:Vmn2r57	UTSW	7	41400195	missense	possibly damaging	0.73
R3937:Vmn2r57	UTSW	7	41428130	missense	probably damaging	0.97
R4193:Vmn2r57	UTSW	7	41428239	missense	probably benign
R4423:Vmn2r57	UTSW	7	41426640	missense	probably damaging	1.00
R4865:Vmn2r57	UTSW	7	41400468	missense	probably damaging	1.00
R4947:Vmn2r57	UTSW	7	41400495	missense	probably damaging	1.00
R5042:Vmn2r57	UTSW	7	41428662	missense	probably benign	0.06
R5084:Vmn2r57	UTSW	7	41426550	critical splice donor site	probably null
R5177:Vmn2r57	UTSW	7	41400240	missense	probably benign	0.31
R5192:Vmn2r57	UTSW	7	41427939	missense	probably damaging	0.96
R5745:Vmn2r57	UTSW	7	41448471	missense	possibly damaging	0.51
R6051:Vmn2r57	UTSW	7	41448472	missense	probably benign	0.00
R6155:Vmn2r57	UTSW	7	41428690	missense	probably benign	0.14
R6248:Vmn2r57	UTSW	7	41399860	missense	probably benign
R6381:Vmn2r57	UTSW	7	41428818	missense	probably benign	0.08
R7019:Vmn2r57	UTSW	7	41428665	missense	probably damaging	1.00
R7126:Vmn2r57	UTSW	7	41399794	missense	possibly damaging	0.93
R7146:Vmn2r57	UTSW	7	41448471	missense	possibly damaging	0.51
R7215:Vmn2r57	UTSW	7	41400286	missense	probably benign	0.00
R7432:Vmn2r57	UTSW	7	41426724	missense	probably benign	0.01
R7633:Vmn2r57	UTSW	7	41425089	missense	possibly damaging	0.76
R7811:Vmn2r57	UTSW	7	41425015	nonsense	probably null
R8025:Vmn2r57	UTSW	7	41426759	missense	probably benign	0.00
R8332:Vmn2r57	UTSW	7	41400253	missense	probably benign	0.01
R8345:Vmn2r57	UTSW	7	41427544	missense	possibly damaging	0.81
R8360:Vmn2r57	UTSW	7	41400216	missense	probably damaging	1.00
R8738:Vmn2r57	UTSW	7	41427596	missense	probably benign	0.00
R8758:Vmn2r57	UTSW	7	41428739	missense	probably damaging	1.00
R8955:Vmn2r57	UTSW	7	41400147	missense	possibly damaging	0.64
R8985:Vmn2r57	UTSW	7	41399835	missense	probably benign
R9108:Vmn2r57	UTSW	7	41428768	missense	possibly damaging	0.87
R9160:Vmn2r57	UTSW	7	41426735	missense	possibly damaging	0.48
R9354:Vmn2r57	UTSW	7	41400239	missense	probably benign	0.01
R9566:Vmn2r57	UTSW	7	41427665	missense	probably benign	0.32
R9633:Vmn2r57	UTSW	7	41426582	missense	probably benign	0.00
X0026:Vmn2r57	UTSW	7	41428125	missense	probably benign	0.03
X0026:Vmn2r57	UTSW	7	41428561	missense	possibly damaging	0.91
X0065:Vmn2r57	UTSW	7	41427971	missense	probably benign	0.09
Z1176:Vmn2r57	UTSW	7	41400498	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTTCCTGATATCAAGACATGAGTTC -3'
(R):5'- ATGGCTGGCTACCTTTCCAC -3'

Sequencing Primer
(F):5'- CAAGACATGAGTTCTTATCTGGCC -3'
(R):5'- CCACCTTTTATTGATCAAAATGCTC -3'

Posted On

2016-08-04