Incidental Mutation 'R5289:Vmn2r57'
ID424595
Institutional Source Beutler Lab
Gene Symbol Vmn2r57
Ensembl Gene ENSMUSG00000066537
Gene Namevomeronasal 2, receptor 57
SynonymsEG269902
MMRRC Submission 042872-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5289 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location41399732-41448641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41399974 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 784 (S784P)
Ref Sequence ENSEMBL: ENSMUSP00000125817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000165029]
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect probably damaging
Transcript: ENSMUST00000165029
AA Change: S784P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125817
Gene: ENSMUSG00000066537
AA Change: S784P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.4e-44 PFAM
Pfam:NCD3G 514 567 2.7e-23 PFAM
Pfam:7tm_3 600 835 1.8e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170929
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 37,000,109 Q3126K probably damaging Het
Adgrv1 A G 13: 81,521,084 V1731A probably benign Het
Ahcyl1 A G 3: 107,669,890 probably null Het
Aox1 T A 1: 58,092,558 M1042K probably damaging Het
Atp10d C A 5: 72,255,123 Q590K probably benign Het
Atp8b1 G T 18: 64,546,087 N774K possibly damaging Het
Atrnl1 C T 19: 57,657,082 T458M probably damaging Het
BC005561 G A 5: 104,519,657 V682I probably benign Het
Cnr1 T A 4: 33,943,910 C99* probably null Het
Cnr2 A G 4: 135,917,007 Y132C probably damaging Het
Commd9 C T 2: 101,898,894 A115V probably benign Het
Diaph3 A G 14: 86,981,678 F426S probably damaging Het
Diras1 G A 10: 81,022,244 Q58* probably null Het
Dpy19l2 A G 9: 24,695,997 L56P probably benign Het
Dsc1 A T 18: 20,101,853 V248D possibly damaging Het
Frem3 A G 8: 80,612,319 M414V probably benign Het
Frmd4b G T 6: 97,302,348 probably null Het
Gabarapl2 T C 8: 111,942,595 W62R probably damaging Het
Glt1d1 A G 5: 127,644,356 R36G probably benign Het
Grb10 T C 11: 11,944,924 silent Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc A G 2: 34,996,014 probably null Het
Hgd A G 16: 37,628,551 E379G possibly damaging Het
Ifi30 A T 8: 70,766,601 probably benign Het
Iqgap1 T C 7: 80,738,724 I842V possibly damaging Het
Iqsec3 T A 6: 121,386,700 probably null Het
Kalrn A G 16: 34,252,341 S724P possibly damaging Het
Lama2 C A 10: 27,212,073 G903* probably null Het
Lrrc10 T C 10: 117,045,487 V22A probably benign Het
Lzts3 T C 2: 130,636,101 E245G probably benign Het
Man2a1 A G 17: 64,651,227 T246A probably damaging Het
Mfsd13a A G 19: 46,368,280 E240G probably benign Het
Mtor T C 4: 148,466,092 I735T possibly damaging Het
Naa15 A T 3: 51,455,894 H333L probably damaging Het
Nes C A 3: 87,978,418 T1284K probably damaging Het
Nexn T G 3: 152,248,072 H173P probably benign Het
Nid2 T C 14: 19,805,311 V1173A possibly damaging Het
Npepps A G 11: 97,240,927 probably null Het
Pgm2 T A 4: 99,967,069 M313K probably damaging Het
Pih1d3 A T 1: 31,223,527 I197F probably benign Het
Plag1 T A 4: 3,905,545 K48N probably damaging Het
Prok1 G C 3: 107,239,619 L11V probably benign Het
Ptpn9 T C 9: 57,060,063 probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc38a4 A T 15: 97,010,348 F171I possibly damaging Het
Sycp1 A T 3: 102,934,253 N78K possibly damaging Het
Tas2r110 T C 6: 132,868,009 M1T probably null Het
Tmem260 G A 14: 48,486,810 V182M possibly damaging Het
Tmem30a A T 9: 79,776,154 N144K probably damaging Het
Vmn2r108 A G 17: 20,471,604 L219P probably damaging Het
Vwf T C 6: 125,667,510 probably benign Het
Wdr62 A C 7: 30,267,875 V318G probably damaging Het
Zfp398 T A 6: 47,863,181 S115T probably benign Het
Zfp62 T A 11: 49,217,148 C689S probably damaging Het
Zmynd15 C G 11: 70,466,004 P580R unknown Het
Other mutations in Vmn2r57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vmn2r57 APN 7 41428785 missense probably benign
IGL01108:Vmn2r57 APN 7 41427584 missense probably benign 0.01
IGL01112:Vmn2r57 APN 7 41425043 missense probably damaging 1.00
IGL01516:Vmn2r57 APN 7 41399946 missense probably damaging 1.00
IGL01880:Vmn2r57 APN 7 41400195 missense possibly damaging 0.73
IGL02117:Vmn2r57 APN 7 41400450 missense probably benign 0.00
IGL02500:Vmn2r57 APN 7 41428226 missense probably benign
IGL02801:Vmn2r57 APN 7 41448632 missense probably benign 0.13
IGL02993:Vmn2r57 APN 7 41428074 missense probably benign 0.04
IGL02996:Vmn2r57 APN 7 41399741 missense probably benign 0.02
R0008:Vmn2r57 UTSW 7 41400652 missense probably damaging 1.00
R0032:Vmn2r57 UTSW 7 41399733 splice site probably null
R0305:Vmn2r57 UTSW 7 41427543 missense probably benign 0.00
R0469:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0510:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0847:Vmn2r57 UTSW 7 41428801 missense probably benign 0.00
R1025:Vmn2r57 UTSW 7 41427804 missense probably benign 0.24
R1081:Vmn2r57 UTSW 7 41428211 missense possibly damaging 0.47
R1479:Vmn2r57 UTSW 7 41427830 missense possibly damaging 0.45
R1579:Vmn2r57 UTSW 7 41400124 missense probably benign 0.38
R1764:Vmn2r57 UTSW 7 41400643 missense probably damaging 1.00
R1848:Vmn2r57 UTSW 7 41428107 missense probably damaging 1.00
R2006:Vmn2r57 UTSW 7 41448577 missense probably benign 0.00
R2197:Vmn2r57 UTSW 7 41428825 critical splice acceptor site probably null
R2242:Vmn2r57 UTSW 7 41428074 missense probably benign 0.00
R2394:Vmn2r57 UTSW 7 41400195 missense possibly damaging 0.73
R3937:Vmn2r57 UTSW 7 41428130 missense probably damaging 0.97
R4193:Vmn2r57 UTSW 7 41428239 missense probably benign
R4423:Vmn2r57 UTSW 7 41426640 missense probably damaging 1.00
R4865:Vmn2r57 UTSW 7 41400468 missense probably damaging 1.00
R4947:Vmn2r57 UTSW 7 41400495 missense probably damaging 1.00
R5042:Vmn2r57 UTSW 7 41428662 missense probably benign 0.06
R5084:Vmn2r57 UTSW 7 41426550 critical splice donor site probably null
R5177:Vmn2r57 UTSW 7 41400240 missense probably benign 0.31
R5192:Vmn2r57 UTSW 7 41427939 missense probably damaging 0.96
R5745:Vmn2r57 UTSW 7 41448471 missense possibly damaging 0.51
R6051:Vmn2r57 UTSW 7 41448472 missense probably benign 0.00
R6155:Vmn2r57 UTSW 7 41428690 missense probably benign 0.14
R6248:Vmn2r57 UTSW 7 41399860 missense probably benign
R6381:Vmn2r57 UTSW 7 41428818 missense probably benign 0.08
R7019:Vmn2r57 UTSW 7 41428665 missense probably damaging 1.00
R7126:Vmn2r57 UTSW 7 41399794 missense possibly damaging 0.93
R7146:Vmn2r57 UTSW 7 41448471 missense possibly damaging 0.51
R7215:Vmn2r57 UTSW 7 41400286 missense probably benign 0.00
R7432:Vmn2r57 UTSW 7 41426724 missense probably benign 0.01
R7633:Vmn2r57 UTSW 7 41425089 missense possibly damaging 0.76
R7811:Vmn2r57 UTSW 7 41425015 nonsense probably null
X0026:Vmn2r57 UTSW 7 41428125 missense probably benign 0.03
X0026:Vmn2r57 UTSW 7 41428561 missense possibly damaging 0.91
X0065:Vmn2r57 UTSW 7 41427971 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTTCCTGATATCAAGACATGAGTTC -3'
(R):5'- ATGGCTGGCTACCTTTCCAC -3'

Sequencing Primer
(F):5'- CAAGACATGAGTTCTTATCTGGCC -3'
(R):5'- CCACCTTTTATTGATCAAAATGCTC -3'
Posted On2016-08-04