Incidental Mutation 'R5289:Ifi30'
ID424598
Institutional Source Beutler Lab
Gene Symbol Ifi30
Ensembl Gene ENSMUSG00000031838
Gene Nameinterferon gamma inducible protein 30
SynonymsGILT, lysosomal thio reductase IP30 precursor, IP30
MMRRC Submission 042872-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5289 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70762774-70766663 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 70766601 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034299
SMART Domains Protein: ENSMUSP00000034299
Gene: ENSMUSG00000031838

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:GILT 60 163 4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143785
SMART Domains Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
Blast:RhoGAP 1 30 1e-8 BLAST
Pfam:SH2 33 70 4.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222087
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysosomal thiol reductase that at low pH can reduce protein disulfide bonds. The enzyme is expressed constitutively in antigen-presenting cells and induced by gamma-interferon in other cell types. This enzyme has an important role in MHC class II-restricted antigen processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: No phenotypic abormalities have been reported in mice homozygous for disruptions in this gene other than reduced efficiency in processing some antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 37,000,109 Q3126K probably damaging Het
Adgrv1 A G 13: 81,521,084 V1731A probably benign Het
Ahcyl1 A G 3: 107,669,890 probably null Het
Aox1 T A 1: 58,092,558 M1042K probably damaging Het
Atp10d C A 5: 72,255,123 Q590K probably benign Het
Atp8b1 G T 18: 64,546,087 N774K possibly damaging Het
Atrnl1 C T 19: 57,657,082 T458M probably damaging Het
BC005561 G A 5: 104,519,657 V682I probably benign Het
Cnr1 T A 4: 33,943,910 C99* probably null Het
Cnr2 A G 4: 135,917,007 Y132C probably damaging Het
Commd9 C T 2: 101,898,894 A115V probably benign Het
Diaph3 A G 14: 86,981,678 F426S probably damaging Het
Diras1 G A 10: 81,022,244 Q58* probably null Het
Dpy19l2 A G 9: 24,695,997 L56P probably benign Het
Dsc1 A T 18: 20,101,853 V248D possibly damaging Het
Frem3 A G 8: 80,612,319 M414V probably benign Het
Frmd4b G T 6: 97,302,348 probably null Het
Gabarapl2 T C 8: 111,942,595 W62R probably damaging Het
Glt1d1 A G 5: 127,644,356 R36G probably benign Het
Grb10 T C 11: 11,944,924 silent Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc A G 2: 34,996,014 probably null Het
Hgd A G 16: 37,628,551 E379G possibly damaging Het
Iqgap1 T C 7: 80,738,724 I842V possibly damaging Het
Iqsec3 T A 6: 121,386,700 probably null Het
Kalrn A G 16: 34,252,341 S724P possibly damaging Het
Lama2 C A 10: 27,212,073 G903* probably null Het
Lrrc10 T C 10: 117,045,487 V22A probably benign Het
Lzts3 T C 2: 130,636,101 E245G probably benign Het
Man2a1 A G 17: 64,651,227 T246A probably damaging Het
Mfsd13a A G 19: 46,368,280 E240G probably benign Het
Mtor T C 4: 148,466,092 I735T possibly damaging Het
Naa15 A T 3: 51,455,894 H333L probably damaging Het
Nes C A 3: 87,978,418 T1284K probably damaging Het
Nexn T G 3: 152,248,072 H173P probably benign Het
Nid2 T C 14: 19,805,311 V1173A possibly damaging Het
Npepps A G 11: 97,240,927 probably null Het
Pgm2 T A 4: 99,967,069 M313K probably damaging Het
Pih1d3 A T 1: 31,223,527 I197F probably benign Het
Plag1 T A 4: 3,905,545 K48N probably damaging Het
Prok1 G C 3: 107,239,619 L11V probably benign Het
Ptpn9 T C 9: 57,060,063 probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc38a4 A T 15: 97,010,348 F171I possibly damaging Het
Sycp1 A T 3: 102,934,253 N78K possibly damaging Het
Tas2r110 T C 6: 132,868,009 M1T probably null Het
Tmem260 G A 14: 48,486,810 V182M possibly damaging Het
Tmem30a A T 9: 79,776,154 N144K probably damaging Het
Vmn2r108 A G 17: 20,471,604 L219P probably damaging Het
Vmn2r57 A G 7: 41,399,974 S784P probably damaging Het
Vwf T C 6: 125,667,510 probably benign Het
Wdr62 A C 7: 30,267,875 V318G probably damaging Het
Zfp398 T A 6: 47,863,181 S115T probably benign Het
Zfp62 T A 11: 49,217,148 C689S probably damaging Het
Zmynd15 C G 11: 70,466,004 P580R unknown Het
Other mutations in Ifi30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ifi30 APN 8 70764762 unclassified probably benign
IGL02386:Ifi30 APN 8 70764760 unclassified probably benign
R0040:Ifi30 UTSW 8 70763776 splice site probably null
R0040:Ifi30 UTSW 8 70763776 splice site probably null
R0411:Ifi30 UTSW 8 70764918 unclassified probably benign
R0690:Ifi30 UTSW 8 70764949 unclassified probably benign
R2082:Ifi30 UTSW 8 70763728 unclassified probably benign
R5759:Ifi30 UTSW 8 70766544 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCCTGAAGACATTGGAGTTCCC -3'
(R):5'- TGATTTGGGACCAGCACCTG -3'

Sequencing Primer
(F):5'- TTGGAGTTCCCCAAAACGAGTTC -3'
(R):5'- CACTTGCTTAAAGTCTCCC -3'
Posted On2016-08-04