Incidental Mutation 'R5289:Dpy19l2'
ID424601
Institutional Source Beutler Lab
Gene Symbol Dpy19l2
Ensembl Gene ENSMUSG00000085576
Gene Namedpy-19-like 2 (C. elegans)
Synonyms
MMRRC Submission 042872-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5289 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location24557047-24696293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24695997 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 56 (L56P)
Ref Sequence ENSEMBL: ENSMUSP00000132092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133010]
Predicted Effect probably benign
Transcript: ENSMUST00000133010
AA Change: L56P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132092
Gene: ENSMUSG00000085576
AA Change: L56P

DomainStartEndE-ValueType
Pfam:Dpy19 129 772 3.1e-233 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dpy-19 family. It is highly expressed in testis, and is required for sperm head elongation and acrosome formation during spermatogenesis. Mutations in this gene are associated with an infertility disorder, spermatogenic failure type 9 (SPGF9). [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male sterility associated with globozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 37,000,109 Q3126K probably damaging Het
Adgrv1 A G 13: 81,521,084 V1731A probably benign Het
Ahcyl1 A G 3: 107,669,890 probably null Het
Aox1 T A 1: 58,092,558 M1042K probably damaging Het
Atp10d C A 5: 72,255,123 Q590K probably benign Het
Atp8b1 G T 18: 64,546,087 N774K possibly damaging Het
Atrnl1 C T 19: 57,657,082 T458M probably damaging Het
BC005561 G A 5: 104,519,657 V682I probably benign Het
Cnr1 T A 4: 33,943,910 C99* probably null Het
Cnr2 A G 4: 135,917,007 Y132C probably damaging Het
Commd9 C T 2: 101,898,894 A115V probably benign Het
Diaph3 A G 14: 86,981,678 F426S probably damaging Het
Diras1 G A 10: 81,022,244 Q58* probably null Het
Dsc1 A T 18: 20,101,853 V248D possibly damaging Het
Frem3 A G 8: 80,612,319 M414V probably benign Het
Frmd4b G T 6: 97,302,348 probably null Het
Gabarapl2 T C 8: 111,942,595 W62R probably damaging Het
Glt1d1 A G 5: 127,644,356 R36G probably benign Het
Grb10 T C 11: 11,944,924 silent Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc A G 2: 34,996,014 probably null Het
Hgd A G 16: 37,628,551 E379G possibly damaging Het
Ifi30 A T 8: 70,766,601 probably benign Het
Iqgap1 T C 7: 80,738,724 I842V possibly damaging Het
Iqsec3 T A 6: 121,386,700 probably null Het
Kalrn A G 16: 34,252,341 S724P possibly damaging Het
Lama2 C A 10: 27,212,073 G903* probably null Het
Lrrc10 T C 10: 117,045,487 V22A probably benign Het
Lzts3 T C 2: 130,636,101 E245G probably benign Het
Man2a1 A G 17: 64,651,227 T246A probably damaging Het
Mfsd13a A G 19: 46,368,280 E240G probably benign Het
Mtor T C 4: 148,466,092 I735T possibly damaging Het
Naa15 A T 3: 51,455,894 H333L probably damaging Het
Nes C A 3: 87,978,418 T1284K probably damaging Het
Nexn T G 3: 152,248,072 H173P probably benign Het
Nid2 T C 14: 19,805,311 V1173A possibly damaging Het
Npepps A G 11: 97,240,927 probably null Het
Pgm2 T A 4: 99,967,069 M313K probably damaging Het
Pih1d3 A T 1: 31,223,527 I197F probably benign Het
Plag1 T A 4: 3,905,545 K48N probably damaging Het
Prok1 G C 3: 107,239,619 L11V probably benign Het
Ptpn9 T C 9: 57,060,063 probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc38a4 A T 15: 97,010,348 F171I possibly damaging Het
Sycp1 A T 3: 102,934,253 N78K possibly damaging Het
Tas2r110 T C 6: 132,868,009 M1T probably null Het
Tmem260 G A 14: 48,486,810 V182M possibly damaging Het
Tmem30a A T 9: 79,776,154 N144K probably damaging Het
Vmn2r108 A G 17: 20,471,604 L219P probably damaging Het
Vmn2r57 A G 7: 41,399,974 S784P probably damaging Het
Vwf T C 6: 125,667,510 probably benign Het
Wdr62 A C 7: 30,267,875 V318G probably damaging Het
Zfp398 T A 6: 47,863,181 S115T probably benign Het
Zfp62 T A 11: 49,217,148 C689S probably damaging Het
Zmynd15 C G 11: 70,466,004 P580R unknown Het
Other mutations in Dpy19l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Dpy19l2 APN 9 24582818 missense probably damaging 1.00
IGL01137:Dpy19l2 APN 9 24658562 missense possibly damaging 0.78
IGL01586:Dpy19l2 APN 9 24666975 missense probably benign 0.16
IGL02245:Dpy19l2 APN 9 24696025 missense probably benign
IGL02507:Dpy19l2 APN 9 24631267 missense probably benign 0.01
IGL02541:Dpy19l2 APN 9 24658647 missense probably benign 0.00
IGL02644:Dpy19l2 APN 9 24658592 missense probably damaging 1.00
IGL03144:Dpy19l2 APN 9 24646307 missense possibly damaging 0.92
Deferential UTSW 9 24695814 missense probably benign 0.41
polite UTSW 9 24660743 missense possibly damaging 0.91
BB004:Dpy19l2 UTSW 9 24695901 missense probably benign 0.00
BB014:Dpy19l2 UTSW 9 24695901 missense probably benign 0.00
R0022:Dpy19l2 UTSW 9 24696124 missense probably benign
R0029:Dpy19l2 UTSW 9 24558101 missense probably damaging 0.97
R0066:Dpy19l2 UTSW 9 24646383 splice site probably benign
R0066:Dpy19l2 UTSW 9 24646383 splice site probably benign
R0089:Dpy19l2 UTSW 9 24695793 missense probably benign 0.01
R0240:Dpy19l2 UTSW 9 24658580 missense probably damaging 1.00
R0240:Dpy19l2 UTSW 9 24658580 missense probably damaging 1.00
R0349:Dpy19l2 UTSW 9 24695922 missense possibly damaging 0.89
R0491:Dpy19l2 UTSW 9 24696028 missense probably benign 0.09
R0519:Dpy19l2 UTSW 9 24558095 missense probably benign 0.30
R1398:Dpy19l2 UTSW 9 24581263 splice site probably benign
R1465:Dpy19l2 UTSW 9 24669322 missense probably benign 0.04
R1465:Dpy19l2 UTSW 9 24669322 missense probably benign 0.04
R1576:Dpy19l2 UTSW 9 24584502 missense probably benign
R1606:Dpy19l2 UTSW 9 24581215 missense probably benign
R2157:Dpy19l2 UTSW 9 24584632 missense probably benign 0.00
R2157:Dpy19l2 UTSW 9 24680780 missense probably benign 0.02
R2402:Dpy19l2 UTSW 9 24581248 missense probably damaging 1.00
R2409:Dpy19l2 UTSW 9 24658628 missense probably benign 0.00
R3196:Dpy19l2 UTSW 9 24695989 missense probably damaging 1.00
R3419:Dpy19l2 UTSW 9 24581205 missense probably damaging 1.00
R4884:Dpy19l2 UTSW 9 24628180 nonsense probably null
R5950:Dpy19l2 UTSW 9 24581134 missense probably benign 0.10
R6470:Dpy19l2 UTSW 9 24660743 missense possibly damaging 0.91
R7028:Dpy19l2 UTSW 9 24628251 missense probably benign 0.15
R7051:Dpy19l2 UTSW 9 24584493 missense probably benign 0.00
R7095:Dpy19l2 UTSW 9 24695814 missense probably benign 0.41
R7649:Dpy19l2 UTSW 9 24696163 start codon destroyed probably null 0.53
R7927:Dpy19l2 UTSW 9 24695901 missense probably benign 0.00
R7936:Dpy19l2 UTSW 9 24558158 missense probably damaging 1.00
R8076:Dpy19l2 UTSW 9 24680692 missense probably damaging 1.00
R8259:Dpy19l2 UTSW 9 24669406 missense probably benign 0.08
X0067:Dpy19l2 UTSW 9 24585537 missense probably benign 0.00
Z1088:Dpy19l2 UTSW 9 24660824 splice site probably null
Z1177:Dpy19l2 UTSW 9 24646359 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGGAACACTGAGCAGACTCG -3'
(R):5'- ACCTGATCACGGGCTATGAG -3'

Sequencing Primer
(F):5'- CTGTGGGAGAACCGATGCATC -3'
(R):5'- CCTGATCACGGGCTATGAGAAGATG -3'
Posted On2016-08-04