Incidental Mutation 'R5289:Slc38a4'
ID424613
Institutional Source Beutler Lab
Gene Symbol Slc38a4
Ensembl Gene ENSMUSG00000022464
Gene Namesolute carrier family 38, member 4
Synonyms1700012A18Rik, Ata3, 1110012E16Rik
MMRRC Submission 042872-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R5289 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location96994820-97055956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97010348 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 171 (F171I)
Ref Sequence ENSEMBL: ENSMUSP00000155158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023101] [ENSMUST00000166223] [ENSMUST00000230086] [ENSMUST00000230907] [ENSMUST00000231039]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023101
AA Change: F171I

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023101
Gene: ENSMUSG00000022464
AA Change: F171I

DomainStartEndE-ValueType
Pfam:Aa_trans 73 263 4.9e-38 PFAM
Pfam:Aa_trans 302 535 2.1e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166223
AA Change: F171I

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127676
Gene: ENSMUSG00000022464
AA Change: F171I

DomainStartEndE-ValueType
Pfam:Aa_trans 73 262 2.5e-38 PFAM
Pfam:Aa_trans 303 535 2.5e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000230086
AA Change: F171I

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000230907
Predicted Effect possibly damaging
Transcript: ENSMUST00000231039
AA Change: F171I

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC38A4 is found predominantly in liver and transports both cationic and neutral amino acids. The transport of cationic amino acids by SLC38A4 is Na(+) and pH independent, while the transport of neutral amino acids is Na(+) and pH dependent (Hatanaka et al., 2001 [PubMed 11342143]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 37,000,109 Q3126K probably damaging Het
Adgrv1 A G 13: 81,521,084 V1731A probably benign Het
Ahcyl1 A G 3: 107,669,890 probably null Het
Aox1 T A 1: 58,092,558 M1042K probably damaging Het
Atp10d C A 5: 72,255,123 Q590K probably benign Het
Atp8b1 G T 18: 64,546,087 N774K possibly damaging Het
Atrnl1 C T 19: 57,657,082 T458M probably damaging Het
BC005561 G A 5: 104,519,657 V682I probably benign Het
Cnr1 T A 4: 33,943,910 C99* probably null Het
Cnr2 A G 4: 135,917,007 Y132C probably damaging Het
Commd9 C T 2: 101,898,894 A115V probably benign Het
Diaph3 A G 14: 86,981,678 F426S probably damaging Het
Diras1 G A 10: 81,022,244 Q58* probably null Het
Dpy19l2 A G 9: 24,695,997 L56P probably benign Het
Dsc1 A T 18: 20,101,853 V248D possibly damaging Het
Frem3 A G 8: 80,612,319 M414V probably benign Het
Frmd4b G T 6: 97,302,348 probably null Het
Gabarapl2 T C 8: 111,942,595 W62R probably damaging Het
Glt1d1 A G 5: 127,644,356 R36G probably benign Het
Grb10 T C 11: 11,944,924 silent Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc A G 2: 34,996,014 probably null Het
Hgd A G 16: 37,628,551 E379G possibly damaging Het
Ifi30 A T 8: 70,766,601 probably benign Het
Iqgap1 T C 7: 80,738,724 I842V possibly damaging Het
Iqsec3 T A 6: 121,386,700 probably null Het
Kalrn A G 16: 34,252,341 S724P possibly damaging Het
Lama2 C A 10: 27,212,073 G903* probably null Het
Lrrc10 T C 10: 117,045,487 V22A probably benign Het
Lzts3 T C 2: 130,636,101 E245G probably benign Het
Man2a1 A G 17: 64,651,227 T246A probably damaging Het
Mfsd13a A G 19: 46,368,280 E240G probably benign Het
Mtor T C 4: 148,466,092 I735T possibly damaging Het
Naa15 A T 3: 51,455,894 H333L probably damaging Het
Nes C A 3: 87,978,418 T1284K probably damaging Het
Nexn T G 3: 152,248,072 H173P probably benign Het
Nid2 T C 14: 19,805,311 V1173A possibly damaging Het
Npepps A G 11: 97,240,927 probably null Het
Pgm2 T A 4: 99,967,069 M313K probably damaging Het
Pih1d3 A T 1: 31,223,527 I197F probably benign Het
Plag1 T A 4: 3,905,545 K48N probably damaging Het
Prok1 G C 3: 107,239,619 L11V probably benign Het
Ptpn9 T C 9: 57,060,063 probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sycp1 A T 3: 102,934,253 N78K possibly damaging Het
Tas2r110 T C 6: 132,868,009 M1T probably null Het
Tmem260 G A 14: 48,486,810 V182M possibly damaging Het
Tmem30a A T 9: 79,776,154 N144K probably damaging Het
Vmn2r108 A G 17: 20,471,604 L219P probably damaging Het
Vmn2r57 A G 7: 41,399,974 S784P probably damaging Het
Vwf T C 6: 125,667,510 probably benign Het
Wdr62 A C 7: 30,267,875 V318G probably damaging Het
Zfp398 T A 6: 47,863,181 S115T probably benign Het
Zfp62 T A 11: 49,217,148 C689S probably damaging Het
Zmynd15 C G 11: 70,466,004 P580R unknown Het
Other mutations in Slc38a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Slc38a4 APN 15 97019809 missense probably benign 0.01
IGL00229:Slc38a4 APN 15 96999494 missense probably damaging 0.99
IGL00974:Slc38a4 APN 15 96999516 missense probably benign 0.05
IGL01951:Slc38a4 APN 15 97019763 missense probably benign 0.07
R0012:Slc38a4 UTSW 15 96999629 missense probably damaging 1.00
R0012:Slc38a4 UTSW 15 96999629 missense probably damaging 1.00
R0165:Slc38a4 UTSW 15 97008949 missense probably benign 0.00
R0304:Slc38a4 UTSW 15 97008454 missense probably damaging 1.00
R0543:Slc38a4 UTSW 15 97016839 missense possibly damaging 0.52
R0973:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R0973:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R0974:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R1340:Slc38a4 UTSW 15 97010272 splice site probably benign
R1973:Slc38a4 UTSW 15 96999597 missense probably benign 0.36
R2058:Slc38a4 UTSW 15 97008725 missense probably benign 0.22
R2083:Slc38a4 UTSW 15 97008993 missense probably benign 0.00
R2108:Slc38a4 UTSW 15 97008997 missense probably benign
R3908:Slc38a4 UTSW 15 97012994 critical splice acceptor site probably null
R4037:Slc38a4 UTSW 15 96997042 missense probably benign 0.03
R4259:Slc38a4 UTSW 15 96998493 missense probably damaging 1.00
R4260:Slc38a4 UTSW 15 96998493 missense probably damaging 1.00
R4261:Slc38a4 UTSW 15 96998493 missense probably damaging 1.00
R4370:Slc38a4 UTSW 15 97009084 missense possibly damaging 0.48
R4435:Slc38a4 UTSW 15 97009018 missense probably benign
R5638:Slc38a4 UTSW 15 97012990 missense probably damaging 0.99
R5893:Slc38a4 UTSW 15 96999551 missense probably benign 0.23
R7059:Slc38a4 UTSW 15 97009014 nonsense probably null
R7223:Slc38a4 UTSW 15 97010345 missense probably damaging 1.00
R7267:Slc38a4 UTSW 15 97005900 missense probably benign 0.01
R7768:Slc38a4 UTSW 15 97008664 missense probably damaging 1.00
R7903:Slc38a4 UTSW 15 97008928 missense probably benign 0.03
R8314:Slc38a4 UTSW 15 97010309 missense probably benign 0.10
R8385:Slc38a4 UTSW 15 96999512 missense probably damaging 1.00
R8822:Slc38a4 UTSW 15 97009071 missense probably benign 0.12
R8955:Slc38a4 UTSW 15 97016781 missense probably benign
R8962:Slc38a4 UTSW 15 97019803 missense probably benign 0.00
R9000:Slc38a4 UTSW 15 96999594 missense possibly damaging 0.48
R9043:Slc38a4 UTSW 15 97008924 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTTGCCGTTGAGGTACCATTC -3'
(R):5'- CAGACGTCTGCTTATGAAGGG -3'

Sequencing Primer
(F):5'- CGTTGAGGTACCATTCCCTAGAAAAG -3'
(R):5'- TACAGAGTACATGGGGCCTTCTC -3'
Posted On2016-08-04