Incidental Mutation 'R5289:Man2a1'
ID424619
Institutional Source Beutler Lab
Gene Symbol Man2a1
Ensembl Gene ENSMUSG00000024085
Gene Namemannosidase 2, alpha 1
SynonymsMana2, Map-2, Mana-2
MMRRC Submission 042872-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R5289 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location64600736-64755110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64651227 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 246 (T246A)
Ref Sequence ENSEMBL: ENSMUSP00000083928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086723]
Predicted Effect probably damaging
Transcript: ENSMUST00000086723
AA Change: T246A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083928
Gene: ENSMUSG00000024085
AA Change: T246A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 45 74 N/A INTRINSIC
Pfam:Glyco_hydro_38 166 496 2.3e-111 PFAM
Alpha-mann_mid 501 587 5.39e-34 SMART
Pfam:Glyco_hydro_38C 648 1144 1.5e-98 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl hydrolase that localizes to the Golgi and catalyzes the final hydrolytic step in the asparagine-linked oligosaccharide (N-glycan) maturation pathway. Mutations in the mouse homolog of this gene have been shown to cause a systemic autoimmune disease similar to human systemic lupus erythematosus. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mutation of this gene results in premature death, dyserythropoiesis, systemic autoimmune disease, including an increase in serum immunoglobulins, glomerulonephritis, and hematuria, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 37,000,109 Q3126K probably damaging Het
Adgrv1 A G 13: 81,521,084 V1731A probably benign Het
Ahcyl1 A G 3: 107,669,890 probably null Het
Aox1 T A 1: 58,092,558 M1042K probably damaging Het
Atp10d C A 5: 72,255,123 Q590K probably benign Het
Atp8b1 G T 18: 64,546,087 N774K possibly damaging Het
Atrnl1 C T 19: 57,657,082 T458M probably damaging Het
BC005561 G A 5: 104,519,657 V682I probably benign Het
Cnr1 T A 4: 33,943,910 C99* probably null Het
Cnr2 A G 4: 135,917,007 Y132C probably damaging Het
Commd9 C T 2: 101,898,894 A115V probably benign Het
Diaph3 A G 14: 86,981,678 F426S probably damaging Het
Diras1 G A 10: 81,022,244 Q58* probably null Het
Dpy19l2 A G 9: 24,695,997 L56P probably benign Het
Dsc1 A T 18: 20,101,853 V248D possibly damaging Het
Frem3 A G 8: 80,612,319 M414V probably benign Het
Frmd4b G T 6: 97,302,348 probably null Het
Gabarapl2 T C 8: 111,942,595 W62R probably damaging Het
Glt1d1 A G 5: 127,644,356 R36G probably benign Het
Grb10 T C 11: 11,944,924 silent Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc A G 2: 34,996,014 probably null Het
Hgd A G 16: 37,628,551 E379G possibly damaging Het
Ifi30 A T 8: 70,766,601 probably benign Het
Iqgap1 T C 7: 80,738,724 I842V possibly damaging Het
Iqsec3 T A 6: 121,386,700 probably null Het
Kalrn A G 16: 34,252,341 S724P possibly damaging Het
Lama2 C A 10: 27,212,073 G903* probably null Het
Lrrc10 T C 10: 117,045,487 V22A probably benign Het
Lzts3 T C 2: 130,636,101 E245G probably benign Het
Mfsd13a A G 19: 46,368,280 E240G probably benign Het
Mtor T C 4: 148,466,092 I735T possibly damaging Het
Naa15 A T 3: 51,455,894 H333L probably damaging Het
Nes C A 3: 87,978,418 T1284K probably damaging Het
Nexn T G 3: 152,248,072 H173P probably benign Het
Nid2 T C 14: 19,805,311 V1173A possibly damaging Het
Npepps A G 11: 97,240,927 probably null Het
Pgm2 T A 4: 99,967,069 M313K probably damaging Het
Pih1d3 A T 1: 31,223,527 I197F probably benign Het
Plag1 T A 4: 3,905,545 K48N probably damaging Het
Prok1 G C 3: 107,239,619 L11V probably benign Het
Ptpn9 T C 9: 57,060,063 probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc38a4 A T 15: 97,010,348 F171I possibly damaging Het
Sycp1 A T 3: 102,934,253 N78K possibly damaging Het
Tas2r110 T C 6: 132,868,009 M1T probably null Het
Tmem260 G A 14: 48,486,810 V182M possibly damaging Het
Tmem30a A T 9: 79,776,154 N144K probably damaging Het
Vmn2r108 A G 17: 20,471,604 L219P probably damaging Het
Vmn2r57 A G 7: 41,399,974 S784P probably damaging Het
Vwf T C 6: 125,667,510 probably benign Het
Wdr62 A C 7: 30,267,875 V318G probably damaging Het
Zfp398 T A 6: 47,863,181 S115T probably benign Het
Zfp62 T A 11: 49,217,148 C689S probably damaging Het
Zmynd15 C G 11: 70,466,004 P580R unknown Het
Other mutations in Man2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Man2a1 APN 17 64710705 missense probably benign 0.00
IGL01823:Man2a1 APN 17 64666824 missense probably damaging 0.99
IGL02012:Man2a1 APN 17 64666899 missense probably damaging 0.98
IGL02589:Man2a1 APN 17 64679778 missense probably benign 0.01
IGL03248:Man2a1 APN 17 64713611 missense probably damaging 1.00
R0070:Man2a1 UTSW 17 64659079 splice site probably null
R0092:Man2a1 UTSW 17 64659084 splice site probably benign
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1599:Man2a1 UTSW 17 64679831 missense possibly damaging 0.80
R1799:Man2a1 UTSW 17 64669497 missense probably damaging 1.00
R1799:Man2a1 UTSW 17 64752457 missense probably benign 0.12
R1822:Man2a1 UTSW 17 64740842 missense probably damaging 1.00
R1958:Man2a1 UTSW 17 64750835 missense probably benign 0.00
R2852:Man2a1 UTSW 17 64713601 missense probably benign 0.00
R4324:Man2a1 UTSW 17 64666793 missense probably benign 0.00
R4582:Man2a1 UTSW 17 64752499 missense probably benign 0.00
R4610:Man2a1 UTSW 17 64712459 missense probably benign
R4803:Man2a1 UTSW 17 64659009 missense probably damaging 1.00
R5072:Man2a1 UTSW 17 64659079 splice site probably null
R5109:Man2a1 UTSW 17 64752448 missense probably benign 0.31
R5223:Man2a1 UTSW 17 64712271 missense probably benign 0.17
R5229:Man2a1 UTSW 17 64710734 missense probably benign 0.00
R5238:Man2a1 UTSW 17 64636507 missense probably damaging 1.00
R5273:Man2a1 UTSW 17 64733785 missense probably damaging 1.00
R5352:Man2a1 UTSW 17 64731246 missense probably damaging 1.00
R5428:Man2a1 UTSW 17 64712300 missense probably benign 0.00
R5898:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5942:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5943:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5963:Man2a1 UTSW 17 64675122 missense probably benign
R5969:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5970:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R6164:Man2a1 UTSW 17 64733724 missense possibly damaging 0.87
R6207:Man2a1 UTSW 17 64713605 missense probably benign 0.02
R6245:Man2a1 UTSW 17 64710826 missense probably damaging 0.97
R6724:Man2a1 UTSW 17 64731269 missense possibly damaging 0.91
R6759:Man2a1 UTSW 17 64625388 missense probably benign 0.00
R6778:Man2a1 UTSW 17 64714635 missense possibly damaging 0.69
R7250:Man2a1 UTSW 17 64636588 missense probably benign 0.00
R7354:Man2a1 UTSW 17 64752544 missense probably damaging 1.00
R7833:Man2a1 UTSW 17 64666751 missense probably damaging 0.99
R7916:Man2a1 UTSW 17 64666751 missense probably damaging 0.99
RF007:Man2a1 UTSW 17 64712253 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCTAGGAAAAGAAGGGTCACCC -3'
(R):5'- AGGAAAATTAGTTCAGATCCCCTG -3'

Sequencing Primer
(F):5'- TAATATGAGCACTTCATCCCAGGGG -3'
(R):5'- TGAGTGTCCCTTCCCAAGACAG -3'
Posted On2016-08-04