Mutagenetix > Incidental Mutation

Incidental Mutation 'R0491:Alms1'

42462

Institutional Source

Beutler Lab

Gene Symbol

Alms1

Ensembl Gene

ENSMUSG00000063810

Gene Name

ALMS1, centrosome and basal body associated

Synonyms

MMRRC Submission

038689-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0491 (G1)

Quality Score

146

Status

Validated

Chromosome

Chromosomal Location

85587531-85702753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85702600 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 3240 (T3240A)

Ref Sequence

ENSEMBL: ENSMUSP00000071904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000160534] [ENSMUST00000179613] [ENSMUST00000213058]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000072018
AA Change: T3240A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: T3240A

Domain	Start	End	E-Value	Type
coiled coil region	10	39	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
low complexity region	98	119	N/A	INTRINSIC
Blast:MYSc	127	233	1e-21	BLAST
internal_repeat_3	408	511	2.48e-7	PROSPERO
internal_repeat_2	414	804	2.09e-12	PROSPERO
internal_repeat_1	438	834	4.54e-18	PROSPERO
internal_repeat_3	652	757	2.48e-7	PROSPERO
low complexity region	903	908	N/A	INTRINSIC
internal_repeat_1	916	1385	4.54e-18	PROSPERO
internal_repeat_2	1024	1390	2.09e-12	PROSPERO
low complexity region	1572	1586	N/A	INTRINSIC
low complexity region	2004	2017	N/A	INTRINSIC
low complexity region	2760	2773	N/A	INTRINSIC
low complexity region	2950	2968	N/A	INTRINSIC
low complexity region	3013	3030	N/A	INTRINSIC
Pfam:ALMS_motif	3125	3247	1.8e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000160534

SMART Domains

Protein: ENSMUSP00000123947
Gene: ENSMUSG00000089694

Domain	Start	End	E-Value	Type
transmembrane domain	37	56	N/A	INTRINSIC
Pfam:Acetyltransf_10	71	193	1.8e-10	PFAM
Pfam:Acetyltransf_4	75	204	2e-9	PFAM
Pfam:Acetyltransf_7	105	195	5.9e-11	PFAM
Pfam:Acetyltransf_1	112	194	1.2e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179613

SMART Domains

Protein: ENSMUSP00000136338
Gene: ENSMUSG00000089694

Domain	Start	End	E-Value	Type
transmembrane domain	37	56	N/A	INTRINSIC
Pfam:Acetyltransf_10	71	193	2.2e-10	PFAM
Pfam:Acetyltransf_4	75	202	1.8e-8	PFAM
Pfam:Acetyltransf_7	105	195	5.7e-10	PFAM
Pfam:Acetyltransf_1	112	194	1.2e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213058
AA Change: T3709A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

Meta Mutation Damage Score

0.0856

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,182,243	S356T	probably damaging	Het
Abca13	T	C	11: 9,298,235	F2661L	probably benign	Het
Acadsb	A	G	7: 131,430,107	D224G	probably benign	Het
Acsm1	A	G	7: 119,640,697	H288R	probably damaging	Het
Adamts2	A	G	11: 50,776,630	D465G	probably damaging	Het
Akap9	A	T	5: 3,972,851		probably benign	Het
Ap3d1	A	G	10: 80,719,241	W417R	probably damaging	Het
Arfgef1	C	A	1: 10,179,987		probably benign	Het
Atf6	A	G	1: 170,787,344		probably null	Het
Cacna1s	T	A	1: 136,089,008		probably benign	Het
Clcn1	T	C	6: 42,310,581	F740L	probably benign	Het
Clec12a	T	A	6: 129,364,053	D265E	probably benign	Het
Clic3	T	A	2: 25,457,785		probably benign	Het
Cntnap3	T	G	13: 64,762,045	T749P	probably benign	Het
Col11a2	T	A	17: 34,042,212	D45E	probably null	Het
Crxos	T	A	7: 15,898,535	S89T	probably benign	Het
Cxcr1	G	T	1: 74,192,309	P185T	possibly damaging	Het
Cyp20a1	T	A	1: 60,371,327	N262K	possibly damaging	Het
Dpy19l2	T	C	9: 24,696,028	R46G	probably benign	Het
Dpysl2	A	T	14: 66,807,962	L454Q	probably damaging	Het
Dvl3	C	T	16: 20,527,423		probably benign	Het
Eppin	T	A	2: 164,589,412	E98V	possibly damaging	Het
Fancm	A	T	12: 65,106,061	H1097L	probably benign	Het
Fkbp4	A	G	6: 128,435,742	I75T	probably damaging	Het
Fmn2	A	G	1: 174,581,959	H586R	unknown	Het
Gm973	C	T	1: 59,558,234		probably benign	Het
Haus6	A	C	4: 86,602,846	V185G	possibly damaging	Het
Herc2	T	A	7: 56,122,366	C1098S	possibly damaging	Het
Hic1	C	A	11: 75,166,310	L584F	possibly damaging	Het
Itgb1bp1	C	A	12: 21,276,895		probably benign	Het
Kbtbd2	G	A	6: 56,780,389	R121*	probably null	Het
Lgr4	C	T	2: 110,007,281		probably benign	Het
Lrrc55	T	C	2: 85,191,920	E309G	probably damaging	Het
Mertk	T	C	2: 128,793,107		probably null	Het
Micu3	A	G	8: 40,366,253		probably benign	Het
Mmp11	G	A	10: 75,926,758	A287V	probably benign	Het
Mpzl2	A	G	9: 45,042,741	Y47C	probably damaging	Het
Muc5b	A	C	7: 141,862,015	R2899S	probably benign	Het
Myo1b	A	G	1: 51,755,698	Y1078H	probably benign	Het
Naip1	A	T	13: 100,423,219	D1092E	probably benign	Het
Ncapd3	T	G	9: 27,057,883	V611G	probably damaging	Het
Ntpcr	C	T	8: 125,737,354	R73*	probably null	Het
Olfr1225	A	T	2: 89,170,360	V284E	probably benign	Het
Olfr1475	G	A	19: 13,479,493	A235V	probably damaging	Het
Osbp2	A	G	11: 3,714,709	F88S	probably damaging	Het
Pkn3	A	T	2: 30,089,877	T711S	probably damaging	Het
Plekhm1	T	C	11: 103,394,776	K278E	probably benign	Het
Ppp1r36	A	G	12: 76,439,291	T408A	probably benign	Het
Prss41	T	C	17: 23,842,503	T105A	possibly damaging	Het
Psme1	G	T	14: 55,579,921		probably benign	Het
Ptprq	A	T	10: 107,608,175	Y1523N	probably damaging	Het
Ric8b	A	G	10: 84,992,222	D470G	probably damaging	Het
Scarb1	A	G	5: 125,298,731		probably benign	Het
Slc25a54	G	A	3: 109,102,796	A204T	probably damaging	Het
Spink10	T	C	18: 62,659,965	C67R	probably damaging	Het
St5	T	A	7: 109,557,204	Q113L	probably benign	Het
Tmtc1	A	T	6: 148,412,640		probably null	Het
Tprkb	A	G	6: 85,924,464	D28G	probably benign	Het
Ttll13	A	G	7: 80,260,350	H747R	probably benign	Het
Usp24	A	G	4: 106,402,105	S1608G	probably benign	Het
Utp20	A	T	10: 88,760,912	F2115L	probably damaging	Het
Vmn1r200	A	T	13: 22,395,191	I46L	probably benign	Het
Zdhhc8	A	T	16: 18,228,390	M103K	probably damaging	Het
Zfp595	C	T	13: 67,317,305	G298E	probably damaging	Het
Zfp738	T	G	13: 67,670,021	H617P	possibly damaging	Het
Zfp9	A	T	6: 118,465,202	H166Q	probably damaging	Het
Zp3r	C	A	1: 130,618,334	D80Y	probably damaging	Het

Other mutations in Alms1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Alms1	APN	6	85677964	missense	probably damaging	1.00
IGL00331:Alms1	APN	6	85641371	missense	possibly damaging	0.94
IGL00658:Alms1	APN	6	85628961	missense	probably damaging	1.00
IGL00835:Alms1	APN	6	85622134	missense	probably damaging	1.00
IGL00930:Alms1	APN	6	85601310	missense	probably damaging	0.98
IGL01446:Alms1	APN	6	85696701	missense	probably damaging	1.00
IGL01448:Alms1	APN	6	85677899	missense	possibly damaging	0.93
IGL01563:Alms1	APN	6	85627983	missense	probably damaging	1.00
IGL01632:Alms1	APN	6	85627946	missense	probably benign	0.07
IGL01651:Alms1	APN	6	85656476	missense	probably benign	0.05
IGL01670:Alms1	APN	6	85678150	missense	probably benign	0.00
IGL01716:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01719:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01720:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01723:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01877:Alms1	APN	6	85622411	missense	possibly damaging	0.55
IGL01919:Alms1	APN	6	85628004	missense	possibly damaging	0.77
IGL01976:Alms1	APN	6	85622665	missense	possibly damaging	0.73
IGL02003:Alms1	APN	6	85622223	missense	possibly damaging	0.54
IGL02069:Alms1	APN	6	85628823	missense	probably benign	0.12
IGL02070:Alms1	APN	6	85651403	missense	possibly damaging	0.74
IGL02079:Alms1	APN	6	85628634	missense	probably damaging	0.98
IGL02081:Alms1	APN	6	85620303	missense	possibly damaging	0.55
IGL02379:Alms1	APN	6	85629633	missense	probably damaging	0.98
IGL02412:Alms1	APN	6	85628872	missense	possibly damaging	0.91
IGL02606:Alms1	APN	6	85599967	missense	probably benign
IGL02636:Alms1	APN	6	85628654	missense	probably benign	0.28
IGL02702:Alms1	APN	6	85599849	missense	probably benign	0.12
IGL02815:Alms1	APN	6	85667957	critical splice donor site	probably null
IGL02926:Alms1	APN	6	85641450	missense	probably damaging	1.00
IGL02945:Alms1	APN	6	85620933	missense	probably damaging	0.96
IGL02959:Alms1	APN	6	85629052	nonsense	probably null
IGL03124:Alms1	APN	6	85678419	missense	probably benign	0.03
IGL03199:Alms1	APN	6	85622497	missense	possibly damaging	0.68
IGL03209:Alms1	APN	6	85599973	splice site	probably benign
IGL03247:Alms1	APN	6	85678597	missense	possibly damaging	0.85
ares	UTSW	6	85621275	nonsense	probably null
ares2	UTSW	6	85677990	nonsense	probably null
butterball	UTSW	6	85696771	missense	probably damaging	0.99
earthquake	UTSW	6	85628735	nonsense	probably null
fatty	UTSW	6	85627934	nonsense	probably null
gut_check	UTSW	6	85620369	nonsense	probably null
portly	UTSW	6	85619712	missense	probably benign	0.00
replete	UTSW	6	85629208	missense	possibly damaging	0.87
PIT4468001:Alms1	UTSW	6	85624719	critical splice donor site	probably null
R0003:Alms1	UTSW	6	85629210	missense	possibly damaging	0.90
R0095:Alms1	UTSW	6	85620253	missense	possibly damaging	0.90
R0110:Alms1	UTSW	6	85620369	nonsense	probably null
R0114:Alms1	UTSW	6	85619803	missense	probably benign	0.00
R0153:Alms1	UTSW	6	85641381	missense	possibly damaging	0.94
R0217:Alms1	UTSW	6	85622930	missense	probably damaging	0.99
R0328:Alms1	UTSW	6	85610814	splice site	probably null
R0410:Alms1	UTSW	6	85587803	missense	unknown
R0469:Alms1	UTSW	6	85620369	nonsense	probably null
R0510:Alms1	UTSW	6	85620369	nonsense	probably null
R0522:Alms1	UTSW	6	85621615	missense	probably benign
R0525:Alms1	UTSW	6	85587760	missense	unknown
R0611:Alms1	UTSW	6	85678671	missense	possibly damaging	0.61
R0637:Alms1	UTSW	6	85623033	missense	possibly damaging	0.85
R0718:Alms1	UTSW	6	85621821	missense	probably benign	0.00
R0831:Alms1	UTSW	6	85628520	missense	probably benign	0.00
R1318:Alms1	UTSW	6	85628549	missense	possibly damaging	0.62
R1340:Alms1	UTSW	6	85667957	critical splice donor site	probably null
R1561:Alms1	UTSW	6	85629052	nonsense	probably null
R1648:Alms1	UTSW	6	85678402	missense	probably damaging	0.99
R1697:Alms1	UTSW	6	85622454	missense	possibly damaging	0.94
R1699:Alms1	UTSW	6	85622880	missense	possibly damaging	0.46
R1715:Alms1	UTSW	6	85629052	nonsense	probably null
R1723:Alms1	UTSW	6	85628753	missense	probably damaging	1.00
R1734:Alms1	UTSW	6	85641550	critical splice donor site	probably null
R1758:Alms1	UTSW	6	85628505	missense	probably damaging	0.99
R1804:Alms1	UTSW	6	85621275	nonsense	probably null
R1835:Alms1	UTSW	6	85678503	missense	possibly damaging	0.94
R1836:Alms1	UTSW	6	85678503	missense	possibly damaging	0.94
R2077:Alms1	UTSW	6	85622309	missense	possibly damaging	0.93
R2246:Alms1	UTSW	6	85622967	missense	possibly damaging	0.91
R2254:Alms1	UTSW	6	85619848	missense	probably damaging	1.00
R2280:Alms1	UTSW	6	85677973	missense	probably damaging	0.99
R2516:Alms1	UTSW	6	85667963	splice site	probably benign
R2519:Alms1	UTSW	6	85667963	splice site	probably benign
R2566:Alms1	UTSW	6	85622482	missense	possibly damaging	0.84
R2850:Alms1	UTSW	6	85621299	missense	probably benign	0.00
R2850:Alms1	UTSW	6	85667963	splice site	probably benign
R2932:Alms1	UTSW	6	85620562	missense	possibly damaging	0.89
R2944:Alms1	UTSW	6	85628391	missense	probably damaging	1.00
R2980:Alms1	UTSW	6	85628835	missense	probably damaging	1.00
R3084:Alms1	UTSW	6	85678140	missense	probably benign
R3086:Alms1	UTSW	6	85678140	missense	probably benign
R3122:Alms1	UTSW	6	85667963	splice site	probably benign
R3404:Alms1	UTSW	6	85667963	splice site	probably benign
R3405:Alms1	UTSW	6	85667963	splice site	probably benign
R3804:Alms1	UTSW	6	85619647	missense	probably damaging	1.00
R3904:Alms1	UTSW	6	85621678	missense	probably benign	0.00
R4014:Alms1	UTSW	6	85678352	missense	probably benign	0.41
R4056:Alms1	UTSW	6	85587803	missense	unknown
R4067:Alms1	UTSW	6	85621289	missense	probably damaging	1.00
R4110:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4111:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4112:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4194:Alms1	UTSW	6	85677990	nonsense	probably null
R4464:Alms1	UTSW	6	85620021	missense	possibly damaging	0.66
R4539:Alms1	UTSW	6	85620478	missense	possibly damaging	0.78
R4554:Alms1	UTSW	6	85624617	missense	probably benign
R4696:Alms1	UTSW	6	85620522	missense	probably damaging	1.00
R4825:Alms1	UTSW	6	85678245	missense	probably damaging	0.99
R4921:Alms1	UTSW	6	85628546	missense	probably benign	0.13
R5030:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R5051:Alms1	UTSW	6	85627934	nonsense	probably null
R5085:Alms1	UTSW	6	85620732	missense	possibly damaging	0.55
R5141:Alms1	UTSW	6	85621432	missense	probably benign	0.01
R5233:Alms1	UTSW	6	85656371	splice site	probably null
R5310:Alms1	UTSW	6	85615368	missense	possibly damaging	0.79
R5344:Alms1	UTSW	6	85696789	missense	probably benign	0.04
R5394:Alms1	UTSW	6	85623088	missense	probably benign	0.01
R5460:Alms1	UTSW	6	85696731	missense	probably benign	0.08
R5558:Alms1	UTSW	6	85641329	nonsense	probably null
R5650:Alms1	UTSW	6	85620271	missense	probably damaging	1.00
R5667:Alms1	UTSW	6	85696771	missense	probably damaging	0.99
R5671:Alms1	UTSW	6	85629208	missense	possibly damaging	0.87
R5688:Alms1	UTSW	6	85599895	missense	possibly damaging	0.92
R5815:Alms1	UTSW	6	85622838	missense	probably damaging	0.99
R5892:Alms1	UTSW	6	85620903	missense	probably damaging	0.99
R5947:Alms1	UTSW	6	85619712	missense	probably benign	0.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6144:Alms1	UTSW	6	85623074	missense	probably damaging	0.98
R6258:Alms1	UTSW	6	85628735	nonsense	probably null
R6260:Alms1	UTSW	6	85628735	nonsense	probably null
R6455:Alms1	UTSW	6	85696657	missense	probably damaging	0.99
R6569:Alms1	UTSW	6	85641339	missense	probably benign	0.07
R6637:Alms1	UTSW	6	85619734	missense	possibly damaging	0.78
R6866:Alms1	UTSW	6	85621098	missense	possibly damaging	0.85
R6918:Alms1	UTSW	6	85622661	missense	possibly damaging	0.87
R7121:Alms1	UTSW	6	85624622	missense	probably damaging	1.00
R7179:Alms1	UTSW	6	85621369	missense	probably benign	0.09
R7334:Alms1	UTSW	6	85641450	missense	probably damaging	0.99
R7376:Alms1	UTSW	6	85622106	missense	probably benign	0.10
R7394:Alms1	UTSW	6	85622223	missense	possibly damaging	0.54
R7413:Alms1	UTSW	6	85628306	missense	probably benign	0.03
R7511:Alms1	UTSW	6	85609425	missense	unknown
R7542:Alms1	UTSW	6	85629362	missense	possibly damaging	0.62
R7562:Alms1	UTSW	6	85620412	missense	probably damaging	1.00
R7575:Alms1	UTSW	6	85622159	missense	possibly damaging	0.49
R7577:Alms1	UTSW	6	85615320	missense	probably benign	0.09
R7618:Alms1	UTSW	6	85678417	missense	probably benign	0.07
R7653:Alms1	UTSW	6	85620595	missense	possibly damaging	0.47
R7672:Alms1	UTSW	6	85615351	missense	probably damaging	1.00
R7807:Alms1	UTSW	6	85622976	missense	possibly damaging	0.91
R7815:Alms1	UTSW	6	85615358	missense	probably benign	0.42
R7849:Alms1	UTSW	6	85621497	missense	possibly damaging	0.48
R7944:Alms1	UTSW	6	85641380	missense	probably benign	0.03
R7954:Alms1	UTSW	6	85621162	missense	probably damaging	0.98
R7971:Alms1	UTSW	6	85628679	missense	probably benign
R8048:Alms1	UTSW	6	85641334	missense	probably benign	0.13
R8223:Alms1	UTSW	6	85643240	nonsense	probably null
R8332:Alms1	UTSW	6	85620579	missense	probably benign	0.05
R8374:Alms1	UTSW	6	85608991	missense	probably benign	0.41
R8470:Alms1	UTSW	6	85641375	missense	probably damaging	0.99
R8755:Alms1	UTSW	6	85621574	missense	probably benign	0.01
R8979:Alms1	UTSW	6	85621027	missense	probably damaging	0.98
R9044:Alms1	UTSW	6	85696753	missense	probably damaging	0.98
R9057:Alms1	UTSW	6	85609832	missense	unknown
R9224:Alms1	UTSW	6	85621788	missense	possibly damaging	0.69
R9259:Alms1	UTSW	6	85667891	missense	possibly damaging	0.94
R9401:Alms1	UTSW	6	85678019	nonsense	probably null
R9459:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R9633:Alms1	UTSW	6	85623143	missense	probably damaging	0.99
R9716:Alms1	UTSW	6	85601252	missense	possibly damaging	0.84
R9730:Alms1	UTSW	6	85629438	missense	probably benign	0.00
R9790:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9791:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9802:Alms1	UTSW	6	85629238	missense	possibly damaging	0.61
X0013:Alms1	UTSW	6	85656455	missense	probably damaging	1.00
X0025:Alms1	UTSW	6	85620210	missense	probably damaging	0.96
Z1176:Alms1	UTSW	6	85678418	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- TGTGCTGGGATGCAGTCAGAAC -3'
(R):5'- ACCTGCTCCTCTCCAGATAGGAAAG -3'

Sequencing Primer
(F):5'- GAACTCTAGATCATCTGCTATGGAGG -3'
(R):5'- AGGATTCCTAGGCTCTGAAGA -3'

Posted On

2013-05-23