Incidental Mutation 'R5290:Gsn'
ID424629
Institutional Source Beutler Lab
Gene Symbol Gsn
Ensembl Gene ENSMUSG00000026879
Gene Namegelsolin
Synonyms
MMRRC Submission 042873-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.779) question?
Stock #R5290 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location35256380-35307892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35296472 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 410 (S410N)
Ref Sequence ENSEMBL: ENSMUSP00000028239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028239] [ENSMUST00000142324] [ENSMUST00000201185] [ENSMUST00000202899] [ENSMUST00000202990]
PDB Structure
Gelsolin Domains 4-6 in Active, Actin Free Conformation Identifies Sites of Regulatory Calcium Ions [X-RAY DIFFRACTION]
Crystal structure of Plasmodium falciparum actin I [X-RAY DIFFRACTION]
Crystal structure of Plasmodium berghei actin I with D-loop from muscle actin [X-RAY DIFFRACTION]
Crystal structure of Plasmodium berghei actin II [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028239
AA Change: S410N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028239
Gene: ENSMUSG00000026879
AA Change: S410N

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
GEL 64 162 7.31e-30 SMART
GEL 183 275 1.53e-32 SMART
GEL 299 394 2.59e-30 SMART
GEL 443 540 9.28e-32 SMART
GEL 561 646 1.67e-24 SMART
GEL 666 761 4.04e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142324
SMART Domains Protein: ENSMUSP00000118120
Gene: ENSMUSG00000026879

DomainStartEndE-ValueType
GEL 15 113 7.31e-30 SMART
GEL 134 226 1.53e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201185
AA Change: S361N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144561
Gene: ENSMUSG00000026879
AA Change: S361N

DomainStartEndE-ValueType
GEL 15 113 4.9e-32 SMART
GEL 134 226 9.6e-35 SMART
GEL 250 345 1.6e-32 SMART
GEL 394 491 5.8e-34 SMART
GEL 512 597 1.1e-26 SMART
GEL 617 712 2.7e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202899
SMART Domains Protein: ENSMUSP00000144470
Gene: ENSMUSG00000026879

DomainStartEndE-ValueType
GEL 15 113 4.9e-32 SMART
GEL 134 226 9.6e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202990
AA Change: S372N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144296
Gene: ENSMUSG00000026879
AA Change: S372N

DomainStartEndE-ValueType
GEL 26 124 4.9e-32 SMART
GEL 145 237 9.6e-35 SMART
GEL 261 356 1.6e-32 SMART
GEL 405 502 5.8e-34 SMART
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the "plus" ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in the immune system, platelet and platelet function, bone density, nervous and circulatory system. In addition, there are background related effects on viability and mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A T 16: 90,554,210 noncoding transcript Het
2700049A03Rik C A 12: 71,188,791 P1172T probably benign Het
Abi3bp T A 16: 56,642,475 probably null Het
Apod T A 16: 31,311,066 H24L probably damaging Het
Arfgef3 T C 10: 18,600,460 E1537G probably damaging Het
B020004C17Rik T C 14: 57,016,579 V53A possibly damaging Het
Ccdc113 C A 8: 95,540,796 probably null Het
Cd7 T G 11: 121,038,110 D105A probably damaging Het
Celsr3 C T 9: 108,843,158 T2550M probably benign Het
Col6a5 C T 9: 105,946,083 G25D unknown Het
Cps1 A G 1: 67,172,709 M679V probably benign Het
Dync1h1 A T 12: 110,615,068 T316S probably benign Het
Edrf1 T C 7: 133,650,566 Y449H probably damaging Het
Fam92a T C 4: 12,171,195 Q86R probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flg2 A T 3: 93,220,566 I2262L unknown Het
Flnc T C 6: 29,457,554 L2417P probably damaging Het
Gabrp A T 11: 33,567,310 Y121N probably damaging Het
Gdpd4 A G 7: 97,966,336 T123A possibly damaging Het
Gm4763 T C 7: 24,723,411 E79G probably benign Het
Gpr162 C A 6: 124,861,269 M139I probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtf2f2 T C 14: 75,897,649 Y212C probably damaging Het
Hao2 C T 3: 98,877,177 A291T probably damaging Het
Igkv1-133 A G 6: 67,725,579 T94A possibly damaging Het
Irf2bp1 G A 7: 19,004,998 A188T possibly damaging Het
Itpr1 T C 6: 108,406,145 V1478A possibly damaging Het
Kdm5b T C 1: 134,622,099 probably null Het
Kif5b A T 18: 6,234,882 D49E probably damaging Het
Lmbr1l A G 15: 98,912,242 W113R probably damaging Het
Lrp2 T C 2: 69,513,354 D887G probably damaging Het
Lrrc14 T A 15: 76,713,943 M291K probably benign Het
Mgarp G A 3: 51,388,966 A205V possibly damaging Het
Msl2 T C 9: 101,101,407 probably null Het
Nfix G A 8: 84,713,777 Q487* probably null Het
Notch4 T C 17: 34,565,289 V22A probably benign Het
Npc1l1 T A 11: 6,222,221 Q823L probably benign Het
Obox3 T C 7: 15,626,849 K122E probably benign Het
Olfr282 T C 15: 98,438,332 Y288H probably damaging Het
Olfr446 A G 6: 42,928,038 K269R probably damaging Het
Olfr509 C T 7: 108,646,548 M9I probably benign Het
Plekhh3 T A 11: 101,166,571 M287L possibly damaging Het
Prpf3 A T 3: 95,853,545 I15K probably benign Het
Rpl12-ps1 G T 1: 36,958,342 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Setd2 T C 9: 110,617,831 V2489A probably damaging Het
Slfn10-ps T A 11: 83,029,025 noncoding transcript Het
Smad2 C T 18: 76,262,724 P78L probably damaging Het
Spen G A 4: 141,473,816 T2500I probably damaging Het
Stmnd1 A G 13: 46,299,598 D250G probably benign Het
Tjp2 T G 19: 24,131,204 E181D probably benign Het
Tmem131l T C 3: 83,899,265 D1478G probably benign Het
Trim72 G T 7: 128,010,004 R326L probably benign Het
Ttn A T 2: 76,897,240 probably benign Het
Vmn1r177 A T 7: 23,866,073 M126K probably damaging Het
Vmn1r57 A G 7: 5,221,320 I281M probably damaging Het
Vmn2r108 C A 17: 20,471,403 R286L probably benign Het
Wdr25 T C 12: 108,898,042 S38P probably benign Het
Wdr78 A T 4: 103,049,533 D694E probably benign Het
Zfp937 T A 2: 150,238,309 Y86* probably null Het
Zfr2 CTCAGACTGGTGTCAGAC CTCAGAC 10: 81,246,710 probably null Het
Zswim1 C T 2: 164,825,925 H366Y probably damaging Het
Other mutations in Gsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Gsn APN 2 35284037 missense probably damaging 1.00
IGL02119:Gsn APN 2 35302495 missense probably damaging 1.00
IGL02512:Gsn APN 2 35283950 nonsense probably null
IGL02550:Gsn APN 2 35282607 intron probably benign
IGL02975:Gsn APN 2 35304654 missense probably benign 0.25
IGL03061:Gsn APN 2 35282459 intron probably benign
R0321:Gsn UTSW 2 35290396 missense probably benign 0.03
R0454:Gsn UTSW 2 35304639 missense probably damaging 1.00
R1446:Gsn UTSW 2 35306586 missense probably benign 0.04
R1760:Gsn UTSW 2 35284823 missense probably damaging 1.00
R1974:Gsn UTSW 2 35301471 missense probably damaging 1.00
R2258:Gsn UTSW 2 35290337 missense probably damaging 1.00
R2260:Gsn UTSW 2 35290337 missense probably damaging 1.00
R2281:Gsn UTSW 2 35283918 missense probably benign 0.01
R2495:Gsn UTSW 2 35303193 missense probably damaging 1.00
R2516:Gsn UTSW 2 35283953 missense probably benign
R3896:Gsn UTSW 2 35302638 missense possibly damaging 0.92
R4003:Gsn UTSW 2 35283983 missense probably benign 0.38
R4006:Gsn UTSW 2 35307621 nonsense probably null
R4281:Gsn UTSW 2 35298871 missense probably damaging 1.00
R4291:Gsn UTSW 2 35290420 missense probably benign 0.14
R4692:Gsn UTSW 2 35298871 missense probably damaging 1.00
R4850:Gsn UTSW 2 35283900 splice site probably null
R4895:Gsn UTSW 2 35302578 missense probably damaging 1.00
R5011:Gsn UTSW 2 35298921 missense probably damaging 1.00
R5013:Gsn UTSW 2 35298921 missense probably damaging 1.00
R6472:Gsn UTSW 2 35290451 unclassified probably null
R6764:Gsn UTSW 2 35284044 missense probably damaging 1.00
R7018:Gsn UTSW 2 35293506 missense probably benign 0.03
R7036:Gsn UTSW 2 35292599 missense probably damaging 1.00
R7097:Gsn UTSW 2 35295049 nonsense probably null
R7122:Gsn UTSW 2 35295049 nonsense probably null
R7183:Gsn UTSW 2 35294948 missense probably benign 0.00
R7203:Gsn UTSW 2 35298795 missense probably benign 0.00
R7456:Gsn UTSW 2 35282706 missense possibly damaging 0.84
R7488:Gsn UTSW 2 35296421 missense possibly damaging 0.65
R7880:Gsn UTSW 2 35283927 missense probably damaging 1.00
R7963:Gsn UTSW 2 35283927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCAGGGAGAAGCATGTTC -3'
(R):5'- GGCCTCGATATGCAGACTAG -3'

Sequencing Primer
(F):5'- TCAGGGAGAAGCATGTTCAGTGG -3'
(R):5'- GGCCTCGATATGCAGACTAGATATC -3'
Posted On2016-08-04