Incidental Mutation 'R5290:Flg2'
ID 424637
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
MMRRC Submission 042873-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R5290 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 93104585-93128698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 93127873 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 2262 (I2262L)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: I2262L
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: I2262L

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A T 16: 90,351,098 (GRCm39) noncoding transcript Het
2700049A03Rik C A 12: 71,235,565 (GRCm39) P1172T probably benign Het
Abi3bp T A 16: 56,462,838 (GRCm39) probably null Het
Apod T A 16: 31,129,884 (GRCm39) H24L probably damaging Het
Arfgef3 T C 10: 18,476,208 (GRCm39) E1537G probably damaging Het
B020004C17Rik T C 14: 57,254,036 (GRCm39) V53A possibly damaging Het
Ccdc113 C A 8: 96,267,424 (GRCm39) probably null Het
Cd7 T G 11: 120,928,936 (GRCm39) D105A probably damaging Het
Celsr3 C T 9: 108,720,357 (GRCm39) T2550M probably benign Het
Cibar1 T C 4: 12,171,195 (GRCm39) Q86R probably benign Het
Col6a5 C T 9: 105,823,282 (GRCm39) G25D unknown Het
Cps1 A G 1: 67,211,868 (GRCm39) M679V probably benign Het
Dnai4 A T 4: 102,906,730 (GRCm39) D694E probably benign Het
Dync1h1 A T 12: 110,581,502 (GRCm39) T316S probably benign Het
Edrf1 T C 7: 133,252,295 (GRCm39) Y449H probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Flnc T C 6: 29,457,553 (GRCm39) L2417P probably damaging Het
Gabrp A T 11: 33,517,310 (GRCm39) Y121N probably damaging Het
Gdpd4 A G 7: 97,615,543 (GRCm39) T123A possibly damaging Het
Gpr162 C A 6: 124,838,232 (GRCm39) M139I probably benign Het
Greb1l G A 18: 10,542,427 (GRCm39) E1341K probably damaging Het
Gsn G A 2: 35,186,484 (GRCm39) S410N probably benign Het
Gtf2f2 T C 14: 76,135,089 (GRCm39) Y212C probably damaging Het
Hao2 C T 3: 98,784,493 (GRCm39) A291T probably damaging Het
Igkv1-133 A G 6: 67,702,563 (GRCm39) T94A possibly damaging Het
Irf2bp1 G A 7: 18,738,923 (GRCm39) A188T possibly damaging Het
Itpr1 T C 6: 108,383,106 (GRCm39) V1478A possibly damaging Het
Kdm5b T C 1: 134,549,837 (GRCm39) probably null Het
Kif5b A T 18: 6,234,882 (GRCm39) D49E probably damaging Het
Lmbr1l A G 15: 98,810,123 (GRCm39) W113R probably damaging Het
Lrp2 T C 2: 69,343,698 (GRCm39) D887G probably damaging Het
Lrrc14 T A 15: 76,598,143 (GRCm39) M291K probably benign Het
Lypd11 T C 7: 24,422,836 (GRCm39) E79G probably benign Het
Mgarp G A 3: 51,296,387 (GRCm39) A205V possibly damaging Het
Msl2 T C 9: 100,978,606 (GRCm39) probably null Het
Nfix G A 8: 85,440,406 (GRCm39) Q487* probably null Het
Notch4 T C 17: 34,784,263 (GRCm39) V22A probably benign Het
Npc1l1 T A 11: 6,172,221 (GRCm39) Q823L probably benign Het
Obox3 T C 7: 15,360,774 (GRCm39) K122E probably benign Het
Or10ab5 C T 7: 108,245,755 (GRCm39) M9I probably benign Het
Or2a12 A G 6: 42,904,972 (GRCm39) K269R probably damaging Het
Or8s10 T C 15: 98,336,213 (GRCm39) Y288H probably damaging Het
Plekhh3 T A 11: 101,057,397 (GRCm39) M287L possibly damaging Het
Prpf3 A T 3: 95,760,857 (GRCm39) I15K probably benign Het
Rpl12-ps1 G T 1: 36,997,423 (GRCm39) noncoding transcript Het
Rps8 G C 4: 117,012,352 (GRCm39) probably benign Het
Setd2 T C 9: 110,446,899 (GRCm39) V2489A probably damaging Het
Slfn10-ps T A 11: 82,919,851 (GRCm39) noncoding transcript Het
Smad2 C T 18: 76,395,795 (GRCm39) P78L probably damaging Het
Spen G A 4: 141,201,127 (GRCm39) T2500I probably damaging Het
Stmnd1 A G 13: 46,453,074 (GRCm39) D250G probably benign Het
Tjp2 T G 19: 24,108,568 (GRCm39) E181D probably benign Het
Tmem131l T C 3: 83,806,572 (GRCm39) D1478G probably benign Het
Trim72 G T 7: 127,609,176 (GRCm39) R326L probably benign Het
Ttn A T 2: 76,727,584 (GRCm39) probably benign Het
Vmn1r177 A T 7: 23,565,498 (GRCm39) M126K probably damaging Het
Vmn1r57 A G 7: 5,224,319 (GRCm39) I281M probably damaging Het
Vmn2r108 C A 17: 20,691,665 (GRCm39) R286L probably benign Het
Wdr25 T C 12: 108,863,968 (GRCm39) S38P probably benign Het
Zfp937 T A 2: 150,080,229 (GRCm39) Y86* probably null Het
Zfr2 CTCAGACTGGTGTCAGAC CTCAGAC 10: 81,082,544 (GRCm39) probably null Het
Zswim1 C T 2: 164,667,845 (GRCm39) H366Y probably damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93,109,416 (GRCm39) nonsense probably null
IGL00092:Flg2 APN 3 93,127,162 (GRCm39) missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93,110,585 (GRCm39) missense unknown
IGL01077:Flg2 APN 3 93,127,513 (GRCm39) missense unknown
IGL01093:Flg2 APN 3 93,109,678 (GRCm39) missense unknown
IGL01120:Flg2 APN 3 93,108,475 (GRCm39) missense probably damaging 0.99
IGL01473:Flg2 APN 3 93,110,327 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,122,777 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,120,773 (GRCm39) missense unknown
IGL01686:Flg2 APN 3 93,109,591 (GRCm39) missense unknown
IGL02207:Flg2 APN 3 93,127,435 (GRCm39) missense unknown
IGL02294:Flg2 APN 3 93,111,053 (GRCm39) missense unknown
IGL02418:Flg2 APN 3 93,108,361 (GRCm39) missense probably benign 0.26
IGL02581:Flg2 APN 3 93,127,199 (GRCm39) missense unknown
IGL02719:Flg2 APN 3 93,127,438 (GRCm39) nonsense probably null
IGL02795:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02893:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02958:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03060:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03088:Flg2 APN 3 93,110,498 (GRCm39) missense unknown
IGL03165:Flg2 APN 3 93,121,918 (GRCm39) missense unknown
IGL03342:Flg2 APN 3 93,108,542 (GRCm39) missense probably damaging 1.00
IGL03352:Flg2 APN 3 93,109,801 (GRCm39) missense unknown
IGL02796:Flg2 UTSW 3 93,110,920 (GRCm39) missense unknown
IGL02837:Flg2 UTSW 3 93,109,044 (GRCm39) missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93,111,088 (GRCm39) missense unknown
R0087:Flg2 UTSW 3 93,109,738 (GRCm39) missense unknown
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0315:Flg2 UTSW 3 93,122,029 (GRCm39) missense unknown
R0390:Flg2 UTSW 3 93,107,662 (GRCm39) splice site probably benign
R0462:Flg2 UTSW 3 93,108,744 (GRCm39) missense probably benign 0.18
R0553:Flg2 UTSW 3 93,110,891 (GRCm39) missense unknown
R0828:Flg2 UTSW 3 93,110,639 (GRCm39) missense unknown
R1006:Flg2 UTSW 3 93,108,514 (GRCm39) missense probably benign 0.41
R1444:Flg2 UTSW 3 93,109,620 (GRCm39) missense unknown
R1497:Flg2 UTSW 3 93,127,076 (GRCm39) missense unknown
R1518:Flg2 UTSW 3 93,110,445 (GRCm39) missense unknown
R1737:Flg2 UTSW 3 93,110,928 (GRCm39) missense unknown
R1780:Flg2 UTSW 3 93,110,306 (GRCm39) missense unknown
R1797:Flg2 UTSW 3 93,108,283 (GRCm39) missense probably damaging 1.00
R2065:Flg2 UTSW 3 93,109,538 (GRCm39) missense unknown
R2168:Flg2 UTSW 3 93,109,244 (GRCm39) missense probably damaging 1.00
R2220:Flg2 UTSW 3 93,109,492 (GRCm39) missense unknown
R2292:Flg2 UTSW 3 93,127,984 (GRCm39) missense unknown
R2327:Flg2 UTSW 3 93,110,913 (GRCm39) nonsense probably null
R2512:Flg2 UTSW 3 93,109,082 (GRCm39) missense probably damaging 1.00
R3177:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3277:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3522:Flg2 UTSW 3 93,127,334 (GRCm39) missense unknown
R3779:Flg2 UTSW 3 93,109,730 (GRCm39) missense unknown
R3926:Flg2 UTSW 3 93,110,522 (GRCm39) missense unknown
R4082:Flg2 UTSW 3 93,110,828 (GRCm39) missense unknown
R4407:Flg2 UTSW 3 93,122,176 (GRCm39) missense unknown
R5152:Flg2 UTSW 3 93,122,284 (GRCm39) missense unknown
R5253:Flg2 UTSW 3 93,108,119 (GRCm39) missense probably damaging 1.00
R5464:Flg2 UTSW 3 93,109,277 (GRCm39) missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93,127,753 (GRCm39) missense unknown
R5622:Flg2 UTSW 3 93,109,871 (GRCm39) missense unknown
R5788:Flg2 UTSW 3 93,108,296 (GRCm39) missense probably benign 0.41
R5792:Flg2 UTSW 3 93,110,804 (GRCm39) missense unknown
R5831:Flg2 UTSW 3 93,107,541 (GRCm39) missense probably damaging 1.00
R5877:Flg2 UTSW 3 93,110,756 (GRCm39) missense unknown
R6041:Flg2 UTSW 3 93,127,668 (GRCm39) missense probably benign 0.01
R6189:Flg2 UTSW 3 93,127,381 (GRCm39) missense unknown
R6214:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93,108,579 (GRCm39) missense probably benign 0.36
R6288:Flg2 UTSW 3 93,111,092 (GRCm39) missense unknown
R6413:Flg2 UTSW 3 93,127,683 (GRCm39) missense unknown
R6457:Flg2 UTSW 3 93,127,789 (GRCm39) missense unknown
R6468:Flg2 UTSW 3 93,121,728 (GRCm39) missense unknown
R6667:Flg2 UTSW 3 93,109,068 (GRCm39) missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93,108,642 (GRCm39) nonsense probably null
R6996:Flg2 UTSW 3 93,110,256 (GRCm39) missense unknown
R6996:Flg2 UTSW 3 93,109,977 (GRCm39) missense unknown
R7100:Flg2 UTSW 3 93,111,018 (GRCm39) missense unknown
R7133:Flg2 UTSW 3 93,127,069 (GRCm39) missense unknown
R7180:Flg2 UTSW 3 93,110,140 (GRCm39) missense unknown
R7325:Flg2 UTSW 3 93,110,679 (GRCm39) missense unknown
R7349:Flg2 UTSW 3 93,127,513 (GRCm39) missense unknown
R7531:Flg2 UTSW 3 93,108,177 (GRCm39) missense probably damaging 0.99
R7571:Flg2 UTSW 3 93,127,303 (GRCm39) nonsense probably null
R7684:Flg2 UTSW 3 93,126,956 (GRCm39) missense unknown
R7810:Flg2 UTSW 3 93,107,548 (GRCm39) missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93,128,054 (GRCm39) missense unknown
R8031:Flg2 UTSW 3 93,127,521 (GRCm39) missense unknown
R8078:Flg2 UTSW 3 93,107,582 (GRCm39) missense probably damaging 1.00
R8142:Flg2 UTSW 3 93,122,782 (GRCm39) nonsense probably null
R8156:Flg2 UTSW 3 93,127,390 (GRCm39) missense unknown
R8172:Flg2 UTSW 3 93,108,468 (GRCm39) missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93,110,074 (GRCm39) missense unknown
R8262:Flg2 UTSW 3 93,127,517 (GRCm39) missense unknown
R8269:Flg2 UTSW 3 93,109,187 (GRCm39) missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93,110,069 (GRCm39) missense unknown
R8444:Flg2 UTSW 3 93,107,585 (GRCm39) missense probably damaging 0.97
R8670:Flg2 UTSW 3 93,108,791 (GRCm39) missense probably damaging 0.97
R8755:Flg2 UTSW 3 93,108,120 (GRCm39) missense probably damaging 1.00
R9039:Flg2 UTSW 3 93,110,899 (GRCm39) missense unknown
R9116:Flg2 UTSW 3 93,109,591 (GRCm39) missense unknown
R9214:Flg2 UTSW 3 93,110,884 (GRCm39) missense unknown
R9231:Flg2 UTSW 3 93,109,508 (GRCm39) missense unknown
R9553:Flg2 UTSW 3 93,121,901 (GRCm39) missense unknown
R9607:Flg2 UTSW 3 93,108,719 (GRCm39) missense probably damaging 0.98
R9735:Flg2 UTSW 3 93,127,669 (GRCm39) missense unknown
R9752:Flg2 UTSW 3 93,108,467 (GRCm39) missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93,110,045 (GRCm39) missense unknown
Z1177:Flg2 UTSW 3 93,109,727 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CAACTGTCCAGTCTTGTTTTGATG -3'
(R):5'- ATTGCTATCTAAGTAGGCAGAACC -3'

Sequencing Primer
(F):5'- CCAGTCTTGTTTTGATGATAGCC -3'
(R):5'- GGCAGAACCTGACTTCATTTTC -3'
Posted On 2016-08-04