Incidental Mutation 'R5290:Rps8'
ID424643
Institutional Source Beutler Lab
Gene Symbol Rps8
Ensembl Gene ENSMUSG00000047675
Gene Nameribosomal protein S8
Synonyms
MMRRC Submission 042873-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R5290 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location117153827-117156243 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to C at 117155155 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065896] [ENSMUST00000102696] [ENSMUST00000106436]
Predicted Effect probably benign
Transcript: ENSMUST00000065896
SMART Domains Protein: ENSMUSP00000064261
Gene: ENSMUSG00000028678

DomainStartEndE-ValueType
low complexity region 192 205 N/A INTRINSIC
KISc 252 590 1.04e-131 SMART
coiled coil region 615 647 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083746
Predicted Effect probably benign
Transcript: ENSMUST00000102696
SMART Domains Protein: ENSMUSP00000099757
Gene: ENSMUSG00000047675

DomainStartEndE-ValueType
Pfam:Ribosomal_S8e 1 190 1.9e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106436
SMART Domains Protein: ENSMUSP00000102044
Gene: ENSMUSG00000028678

DomainStartEndE-ValueType
low complexity region 141 154 N/A INTRINSIC
KISc 201 539 1.04e-131 SMART
coiled coil region 564 596 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174941
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S8E family of ribosomal proteins. It is located in the cytoplasm. Increased expression of this gene in colorectal tumors and colon polyps compared to matched normal colonic mucosa has been observed. This gene is co-transcribed with the small nucleolar RNA genes U38A, U38B, U39, and U40, which are located in its fourth, fifth, first, and second introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A T 16: 90,554,210 noncoding transcript Het
2700049A03Rik C A 12: 71,188,791 P1172T probably benign Het
Abi3bp T A 16: 56,642,475 probably null Het
Apod T A 16: 31,311,066 H24L probably damaging Het
Arfgef3 T C 10: 18,600,460 E1537G probably damaging Het
B020004C17Rik T C 14: 57,016,579 V53A possibly damaging Het
Ccdc113 C A 8: 95,540,796 probably null Het
Cd7 T G 11: 121,038,110 D105A probably damaging Het
Celsr3 C T 9: 108,843,158 T2550M probably benign Het
Col6a5 C T 9: 105,946,083 G25D unknown Het
Cps1 A G 1: 67,172,709 M679V probably benign Het
Dync1h1 A T 12: 110,615,068 T316S probably benign Het
Edrf1 T C 7: 133,650,566 Y449H probably damaging Het
Fam92a T C 4: 12,171,195 Q86R probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flg2 A T 3: 93,220,566 I2262L unknown Het
Flnc T C 6: 29,457,554 L2417P probably damaging Het
Gabrp A T 11: 33,567,310 Y121N probably damaging Het
Gdpd4 A G 7: 97,966,336 T123A possibly damaging Het
Gm4763 T C 7: 24,723,411 E79G probably benign Het
Gpr162 C A 6: 124,861,269 M139I probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gsn G A 2: 35,296,472 S410N probably benign Het
Gtf2f2 T C 14: 75,897,649 Y212C probably damaging Het
Hao2 C T 3: 98,877,177 A291T probably damaging Het
Igkv1-133 A G 6: 67,725,579 T94A possibly damaging Het
Irf2bp1 G A 7: 19,004,998 A188T possibly damaging Het
Itpr1 T C 6: 108,406,145 V1478A possibly damaging Het
Kdm5b T C 1: 134,622,099 probably null Het
Kif5b A T 18: 6,234,882 D49E probably damaging Het
Lmbr1l A G 15: 98,912,242 W113R probably damaging Het
Lrp2 T C 2: 69,513,354 D887G probably damaging Het
Lrrc14 T A 15: 76,713,943 M291K probably benign Het
Mgarp G A 3: 51,388,966 A205V possibly damaging Het
Msl2 T C 9: 101,101,407 probably null Het
Nfix G A 8: 84,713,777 Q487* probably null Het
Notch4 T C 17: 34,565,289 V22A probably benign Het
Npc1l1 T A 11: 6,222,221 Q823L probably benign Het
Obox3 T C 7: 15,626,849 K122E probably benign Het
Olfr282 T C 15: 98,438,332 Y288H probably damaging Het
Olfr446 A G 6: 42,928,038 K269R probably damaging Het
Olfr509 C T 7: 108,646,548 M9I probably benign Het
Plekhh3 T A 11: 101,166,571 M287L possibly damaging Het
Prpf3 A T 3: 95,853,545 I15K probably benign Het
Rpl12-ps1 G T 1: 36,958,342 noncoding transcript Het
Setd2 T C 9: 110,617,831 V2489A probably damaging Het
Slfn10-ps T A 11: 83,029,025 noncoding transcript Het
Smad2 C T 18: 76,262,724 P78L probably damaging Het
Spen G A 4: 141,473,816 T2500I probably damaging Het
Stmnd1 A G 13: 46,299,598 D250G probably benign Het
Tjp2 T G 19: 24,131,204 E181D probably benign Het
Tmem131l T C 3: 83,899,265 D1478G probably benign Het
Trim72 G T 7: 128,010,004 R326L probably benign Het
Ttn A T 2: 76,897,240 probably benign Het
Vmn1r177 A T 7: 23,866,073 M126K probably damaging Het
Vmn1r57 A G 7: 5,221,320 I281M probably damaging Het
Vmn2r108 C A 17: 20,471,403 R286L probably benign Het
Wdr25 T C 12: 108,898,042 S38P probably benign Het
Wdr78 A T 4: 103,049,533 D694E probably benign Het
Zfp937 T A 2: 150,238,309 Y86* probably null Het
Zfr2 CTCAGACTGGTGTCAGAC CTCAGAC 10: 81,246,710 probably null Het
Zswim1 C T 2: 164,825,925 H366Y probably damaging Het
Other mutations in Rps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01775:Rps8 APN 4 117155052 missense probably benign 0.31
R4824:Rps8 UTSW 4 117155155 unclassified probably benign
R5687:Rps8 UTSW 4 117155155 unclassified probably benign
R7546:Rps8 UTSW 4 117153907 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACCTCAGGATCTTTCAGCAAG -3'
(R):5'- GCAAGCTTGGTGTGTTCCTTAC -3'

Sequencing Primer
(F):5'- CAGGATCTTTCAGCAAGAACAAATTC -3'
(R):5'- CCTTACTGGGGTTCTTCCTGTG -3'
Posted On2016-08-04