Mutagenetix > Incidental Mutation

Incidental Mutation 'R5290:Rps8'

424643

Institutional Source

Beutler Lab

Gene Symbol

Rps8

Ensembl Gene

ENSMUSG00000047675

Gene Name

ribosomal protein S8

Synonyms

MMRRC Submission

042873-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.948) question?

Stock #

R5290 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

117011033-117013329 bp(-) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to C at 117012352 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000102044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065896] [ENSMUST00000102696] [ENSMUST00000106436]

AlphaFold

P62242

Predicted Effect

probably benign
Transcript: ENSMUST00000065896

SMART Domains

Protein: ENSMUSP00000064261
Gene: ENSMUSG00000028678

Domain	Start	End	E-Value	Type
low complexity region	192	205	N/A	INTRINSIC
KISc	252	590	1.04e-131	SMART
coiled coil region	615	647	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082608

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082817

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083746

Predicted Effect

probably benign
Transcript: ENSMUST00000102696

SMART Domains

Protein: ENSMUSP00000099757
Gene: ENSMUSG00000047675

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S8e	1	190	1.9e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106436

SMART Domains

Protein: ENSMUSP00000102044
Gene: ENSMUSG00000028678

Domain	Start	End	E-Value	Type
low complexity region	141	154	N/A	INTRINSIC
KISc	201	539	1.04e-131	SMART
coiled coil region	564	596	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127037

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140226

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141219

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174939

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137423

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144051

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174941

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S8E family of ribosomal proteins. It is located in the cytoplasm. Increased expression of this gene in colorectal tumors and colon polyps compared to matched normal colonic mucosa has been observed. This gene is co-transcribed with the small nucleolar RNA genes U38A, U38B, U39, and U40, which are located in its fourth, fifth, first, and second introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008E08Rik	A	T	16: 90,351,098 (GRCm39)		noncoding transcript	Het
2700049A03Rik	C	A	12: 71,235,565 (GRCm39)	P1172T	probably benign	Het
Abi3bp	T	A	16: 56,462,838 (GRCm39)		probably null	Het
Apod	T	A	16: 31,129,884 (GRCm39)	H24L	probably damaging	Het
Arfgef3	T	C	10: 18,476,208 (GRCm39)	E1537G	probably damaging	Het
B020004C17Rik	T	C	14: 57,254,036 (GRCm39)	V53A	possibly damaging	Het
Ccdc113	C	A	8: 96,267,424 (GRCm39)		probably null	Het
Cd7	T	G	11: 120,928,936 (GRCm39)	D105A	probably damaging	Het
Celsr3	C	T	9: 108,720,357 (GRCm39)	T2550M	probably benign	Het
Cibar1	T	C	4: 12,171,195 (GRCm39)	Q86R	probably benign	Het
Col6a5	C	T	9: 105,823,282 (GRCm39)	G25D	unknown	Het
Cps1	A	G	1: 67,211,868 (GRCm39)	M679V	probably benign	Het
Dnai4	A	T	4: 102,906,730 (GRCm39)	D694E	probably benign	Het
Dync1h1	A	T	12: 110,581,502 (GRCm39)	T316S	probably benign	Het
Edrf1	T	C	7: 133,252,295 (GRCm39)	Y449H	probably damaging	Het
Fkbpl	G	A	17: 34,864,303 (GRCm39)	A24T	probably benign	Het
Flg2	A	T	3: 93,127,873 (GRCm39)	I2262L	unknown	Het
Flnc	T	C	6: 29,457,553 (GRCm39)	L2417P	probably damaging	Het
Gabrp	A	T	11: 33,517,310 (GRCm39)	Y121N	probably damaging	Het
Gdpd4	A	G	7: 97,615,543 (GRCm39)	T123A	possibly damaging	Het
Gpr162	C	A	6: 124,838,232 (GRCm39)	M139I	probably benign	Het
Greb1l	G	A	18: 10,542,427 (GRCm39)	E1341K	probably damaging	Het
Gsn	G	A	2: 35,186,484 (GRCm39)	S410N	probably benign	Het
Gtf2f2	T	C	14: 76,135,089 (GRCm39)	Y212C	probably damaging	Het
Hao2	C	T	3: 98,784,493 (GRCm39)	A291T	probably damaging	Het
Igkv1-133	A	G	6: 67,702,563 (GRCm39)	T94A	possibly damaging	Het
Irf2bp1	G	A	7: 18,738,923 (GRCm39)	A188T	possibly damaging	Het
Itpr1	T	C	6: 108,383,106 (GRCm39)	V1478A	possibly damaging	Het
Kdm5b	T	C	1: 134,549,837 (GRCm39)		probably null	Het
Kif5b	A	T	18: 6,234,882 (GRCm39)	D49E	probably damaging	Het
Lmbr1l	A	G	15: 98,810,123 (GRCm39)	W113R	probably damaging	Het
Lrp2	T	C	2: 69,343,698 (GRCm39)	D887G	probably damaging	Het
Lrrc14	T	A	15: 76,598,143 (GRCm39)	M291K	probably benign	Het
Lypd11	T	C	7: 24,422,836 (GRCm39)	E79G	probably benign	Het
Mgarp	G	A	3: 51,296,387 (GRCm39)	A205V	possibly damaging	Het
Msl2	T	C	9: 100,978,606 (GRCm39)		probably null	Het
Nfix	G	A	8: 85,440,406 (GRCm39)	Q487*	probably null	Het
Notch4	T	C	17: 34,784,263 (GRCm39)	V22A	probably benign	Het
Npc1l1	T	A	11: 6,172,221 (GRCm39)	Q823L	probably benign	Het
Obox3	T	C	7: 15,360,774 (GRCm39)	K122E	probably benign	Het
Or10ab5	C	T	7: 108,245,755 (GRCm39)	M9I	probably benign	Het
Or2a12	A	G	6: 42,904,972 (GRCm39)	K269R	probably damaging	Het
Or8s10	T	C	15: 98,336,213 (GRCm39)	Y288H	probably damaging	Het
Plekhh3	T	A	11: 101,057,397 (GRCm39)	M287L	possibly damaging	Het
Prpf3	A	T	3: 95,760,857 (GRCm39)	I15K	probably benign	Het
Rpl12-ps1	G	T	1: 36,997,423 (GRCm39)		noncoding transcript	Het
Setd2	T	C	9: 110,446,899 (GRCm39)	V2489A	probably damaging	Het
Slfn10-ps	T	A	11: 82,919,851 (GRCm39)		noncoding transcript	Het
Smad2	C	T	18: 76,395,795 (GRCm39)	P78L	probably damaging	Het
Spen	G	A	4: 141,201,127 (GRCm39)	T2500I	probably damaging	Het
Stmnd1	A	G	13: 46,453,074 (GRCm39)	D250G	probably benign	Het
Tjp2	T	G	19: 24,108,568 (GRCm39)	E181D	probably benign	Het
Tmem131l	T	C	3: 83,806,572 (GRCm39)	D1478G	probably benign	Het
Trim72	G	T	7: 127,609,176 (GRCm39)	R326L	probably benign	Het
Ttn	A	T	2: 76,727,584 (GRCm39)		probably benign	Het
Vmn1r177	A	T	7: 23,565,498 (GRCm39)	M126K	probably damaging	Het
Vmn1r57	A	G	7: 5,224,319 (GRCm39)	I281M	probably damaging	Het
Vmn2r108	C	A	17: 20,691,665 (GRCm39)	R286L	probably benign	Het
Wdr25	T	C	12: 108,863,968 (GRCm39)	S38P	probably benign	Het
Zfp937	T	A	2: 150,080,229 (GRCm39)	Y86*	probably null	Het
Zfr2	CTCAGACTGGTGTCAGAC	CTCAGAC	10: 81,082,544 (GRCm39)		probably null	Het
Zswim1	C	T	2: 164,667,845 (GRCm39)	H366Y	probably damaging	Het

Other mutations in Rps8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01775:Rps8	APN	4	117,012,249 (GRCm39)	missense	probably benign	0.31
R4824:Rps8	UTSW	4	117,012,352 (GRCm39)	unclassified	probably benign
R5687:Rps8	UTSW	4	117,012,352 (GRCm39)	unclassified	probably benign
R7546:Rps8	UTSW	4	117,011,104 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTACCTCAGGATCTTTCAGCAAG -3'
(R):5'- GCAAGCTTGGTGTGTTCCTTAC -3'

Sequencing Primer
(F):5'- CAGGATCTTTCAGCAAGAACAAATTC -3'
(R):5'- CCTTACTGGGGTTCTTCCTGTG -3'

Posted On

2016-08-04