Mutagenetix > Incidental Mutation

Incidental Mutation 'R5290:Itpr1'

424649

Institutional Source

Beutler Lab

Gene Symbol

Itpr1

Ensembl Gene

ENSMUSG00000030102

Gene Name

inositol 1,4,5-trisphosphate receptor 1

Synonyms

P400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt

MMRRC Submission

042873-MU

Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Essential gene?

Possibly essential (E-score: 0.746) question?

Stock #

R5290 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108213096-108551109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108406145 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1478 (V1478A)

Ref Sequence

ENSEMBL: ENSMUSP00000144880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032192
AA Change: V1478A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: V1478A

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1758	1787	N/A	INTRINSIC
Pfam:RIH_assoc	1959	2069	1.2e-33	PFAM
transmembrane domain	2274	2296	N/A	INTRINSIC
Pfam:Ion_trans	2311	2600	9e-22	PFAM
coiled coil region	2683	2732	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203615
AA Change: V1478A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: V1478A

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1757	1786	N/A	INTRINSIC
Pfam:RIH_assoc	1958	2068	1.2e-33	PFAM
transmembrane domain	2273	2295	N/A	INTRINSIC
Pfam:Ion_trans	2310	2599	9e-22	PFAM
coiled coil region	2682	2731	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000212125

Meta Mutation Damage Score

0.8497

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (70/72)

MGI Phenotype

Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]

Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008E08Rik	A	T	16: 90,554,210		noncoding transcript	Het
2700049A03Rik	C	A	12: 71,188,791	P1172T	probably benign	Het
Abi3bp	T	A	16: 56,642,475		probably null	Het
Apod	T	A	16: 31,311,066	H24L	probably damaging	Het
Arfgef3	T	C	10: 18,600,460	E1537G	probably damaging	Het
B020004C17Rik	T	C	14: 57,016,579	V53A	possibly damaging	Het
Ccdc113	C	A	8: 95,540,796		probably null	Het
Cd7	T	G	11: 121,038,110	D105A	probably damaging	Het
Celsr3	C	T	9: 108,843,158	T2550M	probably benign	Het
Col6a5	C	T	9: 105,946,083	G25D	unknown	Het
Cps1	A	G	1: 67,172,709	M679V	probably benign	Het
Dync1h1	A	T	12: 110,615,068	T316S	probably benign	Het
Edrf1	T	C	7: 133,650,566	Y449H	probably damaging	Het
Fam92a	T	C	4: 12,171,195	Q86R	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Flg2	A	T	3: 93,220,566	I2262L	unknown	Het
Flnc	T	C	6: 29,457,554	L2417P	probably damaging	Het
Gabrp	A	T	11: 33,567,310	Y121N	probably damaging	Het
Gdpd4	A	G	7: 97,966,336	T123A	possibly damaging	Het
Gm4763	T	C	7: 24,723,411	E79G	probably benign	Het
Gpr162	C	A	6: 124,861,269	M139I	probably benign	Het
Greb1l	G	A	18: 10,542,427	E1341K	probably damaging	Het
Gsn	G	A	2: 35,296,472	S410N	probably benign	Het
Gtf2f2	T	C	14: 75,897,649	Y212C	probably damaging	Het
Hao2	C	T	3: 98,877,177	A291T	probably damaging	Het
Igkv1-133	A	G	6: 67,725,579	T94A	possibly damaging	Het
Irf2bp1	G	A	7: 19,004,998	A188T	possibly damaging	Het
Kdm5b	T	C	1: 134,622,099		probably null	Het
Kif5b	A	T	18: 6,234,882	D49E	probably damaging	Het
Lmbr1l	A	G	15: 98,912,242	W113R	probably damaging	Het
Lrp2	T	C	2: 69,513,354	D887G	probably damaging	Het
Lrrc14	T	A	15: 76,713,943	M291K	probably benign	Het
Mgarp	G	A	3: 51,388,966	A205V	possibly damaging	Het
Msl2	T	C	9: 101,101,407		probably null	Het
Nfix	G	A	8: 84,713,777	Q487*	probably null	Het
Notch4	T	C	17: 34,565,289	V22A	probably benign	Het
Npc1l1	T	A	11: 6,222,221	Q823L	probably benign	Het
Obox3	T	C	7: 15,626,849	K122E	probably benign	Het
Olfr282	T	C	15: 98,438,332	Y288H	probably damaging	Het
Olfr446	A	G	6: 42,928,038	K269R	probably damaging	Het
Olfr509	C	T	7: 108,646,548	M9I	probably benign	Het
Plekhh3	T	A	11: 101,166,571	M287L	possibly damaging	Het
Prpf3	A	T	3: 95,853,545	I15K	probably benign	Het
Rpl12-ps1	G	T	1: 36,958,342		noncoding transcript	Het
Rps8	G	C	4: 117,155,155		probably benign	Het
Setd2	T	C	9: 110,617,831	V2489A	probably damaging	Het
Slfn10-ps	T	A	11: 83,029,025		noncoding transcript	Het
Smad2	C	T	18: 76,262,724	P78L	probably damaging	Het
Spen	G	A	4: 141,473,816	T2500I	probably damaging	Het
Stmnd1	A	G	13: 46,299,598	D250G	probably benign	Het
Tjp2	T	G	19: 24,131,204	E181D	probably benign	Het
Tmem131l	T	C	3: 83,899,265	D1478G	probably benign	Het
Trim72	G	T	7: 128,010,004	R326L	probably benign	Het
Ttn	A	T	2: 76,897,240		probably benign	Het
Vmn1r177	A	T	7: 23,866,073	M126K	probably damaging	Het
Vmn1r57	A	G	7: 5,221,320	I281M	probably damaging	Het
Vmn2r108	C	A	17: 20,471,403	R286L	probably benign	Het
Wdr25	T	C	12: 108,898,042	S38P	probably benign	Het
Wdr78	A	T	4: 103,049,533	D694E	probably benign	Het
Zfp937	T	A	2: 150,238,309	Y86*	probably null	Het
Zfr2	CTCAGACTGGTGTCAGAC	CTCAGAC	10: 81,246,710		probably null	Het
Zswim1	C	T	2: 164,825,925	H366Y	probably damaging	Het

Other mutations in Itpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Itpr1	APN	6	108471120	missense	probably damaging	0.98
IGL01073:Itpr1	APN	6	108413820	missense	probably benign	0.00
IGL01105:Itpr1	APN	6	108381333	missense	probably benign	0.00
IGL01296:Itpr1	APN	6	108399361	missense	probably damaging	1.00
IGL01325:Itpr1	APN	6	108381208	missense	probably benign	0.01
IGL01418:Itpr1	APN	6	108339624	critical splice donor site	probably null
IGL01464:Itpr1	APN	6	108386727	missense	possibly damaging	0.95
IGL01467:Itpr1	APN	6	108488496	missense	probably damaging	0.96
IGL01645:Itpr1	APN	6	108473599	missense	possibly damaging	0.91
IGL01672:Itpr1	APN	6	108381032	nonsense	probably null
IGL01969:Itpr1	APN	6	108377691	missense	probably damaging	1.00
IGL02164:Itpr1	APN	6	108389483	missense	probably benign	0.08
IGL02206:Itpr1	APN	6	108549820	missense	probably damaging	1.00
IGL02232:Itpr1	APN	6	108417923	missense	probably damaging	1.00
IGL02297:Itpr1	APN	6	108339517	missense	possibly damaging	0.84
IGL02434:Itpr1	APN	6	108489922	splice site	probably null
IGL02568:Itpr1	APN	6	108339554	missense	possibly damaging	0.82
IGL02992:Itpr1	APN	6	108381315	missense	probably damaging	1.00
IGL03109:Itpr1	APN	6	108417981	missense	probably damaging	1.00
IGL03130:Itpr1	APN	6	108523401	missense	probably benign	0.00
IGL03333:Itpr1	APN	6	108380910	unclassified	probably benign
aboriginal	UTSW	6	108515947	missense	probably benign
approximation	UTSW	6	108394841	missense	probably benign
estimate	UTSW	6	108389553	missense	probably null	1.00
icarus	UTSW	6	108410900	missense	probably damaging	1.00
marsupialized	UTSW	6	108394073	splice site	probably null
primordial	UTSW	6	108518755	missense	probably benign	0.06
roo	UTSW	6	108410867	missense	probably benign	0.00
wallaby	UTSW	6	108389387	missense	probably damaging	1.00
P0005:Itpr1	UTSW	6	108381257	missense	probably damaging	1.00
PIT4366001:Itpr1	UTSW	6	108493757	nonsense	probably null
R0019:Itpr1	UTSW	6	108354626	missense	probably damaging	1.00
R0128:Itpr1	UTSW	6	108471209	splice site	probably benign
R0129:Itpr1	UTSW	6	108349676	missense	probably damaging	1.00
R0135:Itpr1	UTSW	6	108488482	splice site	probably benign
R0244:Itpr1	UTSW	6	108473589	missense	probably benign	0.00
R0391:Itpr1	UTSW	6	108378167	missense	probably benign	0.22
R0543:Itpr1	UTSW	6	108515748	splice site	probably benign
R0647:Itpr1	UTSW	6	108383698	missense	probably damaging	1.00
R0766:Itpr1	UTSW	6	108410900	missense	probably damaging	1.00
R0971:Itpr1	UTSW	6	108349629	missense	possibly damaging	0.70
R1083:Itpr1	UTSW	6	108510696	missense	possibly damaging	0.92
R1277:Itpr1	UTSW	6	108339621	missense	probably benign	0.22
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1605:Itpr1	UTSW	6	108349659	missense	possibly damaging	0.77
R1661:Itpr1	UTSW	6	108482897	missense	probably benign	0.38
R1852:Itpr1	UTSW	6	108386706	missense	probably damaging	1.00
R1929:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2012:Itpr1	UTSW	6	108440536	missense	probably benign	0.02
R2027:Itpr1	UTSW	6	108386853	missense	possibly damaging	0.80
R2111:Itpr1	UTSW	6	108378309	unclassified	probably benign
R2166:Itpr1	UTSW	6	108388225	missense	probably damaging	1.00
R2272:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2484:Itpr1	UTSW	6	108369110	missense	probably damaging	1.00
R3115:Itpr1	UTSW	6	108406109	missense	possibly damaging	0.55
R3751:Itpr1	UTSW	6	108349680	missense	probably damaging	1.00
R3798:Itpr1	UTSW	6	108381270	missense	probably damaging	1.00
R3930:Itpr1	UTSW	6	108394841	missense	probably benign
R4081:Itpr1	UTSW	6	108391835	missense	probably damaging	1.00
R4119:Itpr1	UTSW	6	108394355	missense	probably benign
R4406:Itpr1	UTSW	6	108354663	missense	probably damaging	1.00
R4506:Itpr1	UTSW	6	108432686	missense	probably damaging	1.00
R4616:Itpr1	UTSW	6	108481223	missense	probably damaging	1.00
R4655:Itpr1	UTSW	6	108481293	missense	probably damaging	1.00
R4661:Itpr1	UTSW	6	108410931	critical splice donor site	probably null
R4760:Itpr1	UTSW	6	108349632	missense	probably benign	0.29
R4836:Itpr1	UTSW	6	108389537	missense	probably damaging	0.99
R4857:Itpr1	UTSW	6	108410867	missense	probably benign	0.00
R4876:Itpr1	UTSW	6	108482906	missense	probably damaging	0.97
R4939:Itpr1	UTSW	6	108440558	nonsense	probably null
R5076:Itpr1	UTSW	6	108405529	splice site	probably null
R5088:Itpr1	UTSW	6	108389387	missense	probably damaging	1.00
R5248:Itpr1	UTSW	6	108542062	missense	probably damaging	1.00
R5308:Itpr1	UTSW	6	108356511	missense	probably damaging	1.00
R5339:Itpr1	UTSW	6	108393961	missense	probably damaging	1.00
R5368:Itpr1	UTSW	6	108387498	missense	probably damaging	1.00
R5369:Itpr1	UTSW	6	108519424	missense	probably damaging	0.99
R5419:Itpr1	UTSW	6	108493794	missense	possibly damaging	0.95
R5615:Itpr1	UTSW	6	108488600	missense	possibly damaging	0.71
R5779:Itpr1	UTSW	6	108352143	missense	probably damaging	1.00
R5781:Itpr1	UTSW	6	108510738	missense	probably benign	0.23
R5869:Itpr1	UTSW	6	108473529	missense	probably benign	0.30
R5903:Itpr1	UTSW	6	108489797	intron	probably benign
R5929:Itpr1	UTSW	6	108423336	missense	probably benign
R5956:Itpr1	UTSW	6	108506027	missense	probably benign	0.25
R6160:Itpr1	UTSW	6	108518755	missense	probably benign	0.06
R6163:Itpr1	UTSW	6	108388284	missense	probably damaging	1.00
R6169:Itpr1	UTSW	6	108369116	missense	probably damaging	1.00
R6237:Itpr1	UTSW	6	108378203	missense	possibly damaging	0.53
R6398:Itpr1	UTSW	6	108505903	missense	probably damaging	0.96
R6455:Itpr1	UTSW	6	108417972	missense	probably damaging	1.00
R6522:Itpr1	UTSW	6	108388276	missense	probably damaging	1.00
R6524:Itpr1	UTSW	6	108363683	missense	probably damaging	1.00
R6650:Itpr1	UTSW	6	108394073	splice site	probably null
R6806:Itpr1	UTSW	6	108515947	missense	probably benign
R6838:Itpr1	UTSW	6	108471191	missense	possibly damaging	0.87
R6841:Itpr1	UTSW	6	108388192	missense	probably damaging	1.00
R6896:Itpr1	UTSW	6	108481394	missense	probably damaging	1.00
R7014:Itpr1	UTSW	6	108431498	critical splice donor site	probably null
R7076:Itpr1	UTSW	6	108388296	missense	probably benign
R7116:Itpr1	UTSW	6	108481268	missense	probably damaging	0.99
R7152:Itpr1	UTSW	6	108394407	critical splice donor site	probably null
R7161:Itpr1	UTSW	6	108386640	missense	probably damaging	1.00
R7166:Itpr1	UTSW	6	108378190	missense	probably benign	0.06
R7241:Itpr1	UTSW	6	108517620	critical splice donor site	probably null
R7301:Itpr1	UTSW	6	108542024	missense	possibly damaging	0.86
R7330:Itpr1	UTSW	6	108438331	missense	probably benign	0.28
R7449:Itpr1	UTSW	6	108389384	missense	probably damaging	0.98
R7472:Itpr1	UTSW	6	108403396	missense	probably benign	0.05
R7502:Itpr1	UTSW	6	108383678	missense	probably benign	0.00
R7779:Itpr1	UTSW	6	108523348	missense	possibly damaging	0.75
R7828:Itpr1	UTSW	6	108482931	missense	probably damaging	1.00
R7854:Itpr1	UTSW	6	108387369	missense	probably damaging	1.00
R7974:Itpr1	UTSW	6	108523405	missense	possibly damaging	0.86
R7998:Itpr1	UTSW	6	108417948	missense	possibly damaging	0.88
R8039:Itpr1	UTSW	6	108386628	missense	probably damaging	1.00
R8136:Itpr1	UTSW	6	108438360	missense	probably benign	0.18
R8200:Itpr1	UTSW	6	108394865	missense	probably benign	0.00
R8242:Itpr1	UTSW	6	108386697	missense	probably benign	0.44
R8322:Itpr1	UTSW	6	108388229	missense	probably benign	0.05
R8377:Itpr1	UTSW	6	108510738	missense	probably benign	0.00
R8412:Itpr1	UTSW	6	108363620	missense	probably benign	0.07
R8443:Itpr1	UTSW	6	108519348	missense	probably damaging	0.99
R8669:Itpr1	UTSW	6	108393967	missense	probably damaging	0.99
R8697:Itpr1	UTSW	6	108523366	missense	probably damaging	1.00
R8744:Itpr1	UTSW	6	108377802	missense	possibly damaging	0.79
R8870:Itpr1	UTSW	6	108388211	missense	probably damaging	1.00
R8921:Itpr1	UTSW	6	108378198	missense	possibly damaging	0.87
R8961:Itpr1	UTSW	6	108493705	missense	possibly damaging	0.86
R9095:Itpr1	UTSW	6	108387391	missense	probably benign	0.02
R9205:Itpr1	UTSW	6	108489849	missense	probably damaging	0.99
R9282:Itpr1	UTSW	6	108394023	missense	probably damaging	1.00
R9323:Itpr1	UTSW	6	108352018	missense	probably damaging	1.00
R9376:Itpr1	UTSW	6	108349677	missense	probably damaging	0.99
R9392:Itpr1	UTSW	6	108413876	missense	probably benign
R9428:Itpr1	UTSW	6	108401347	missense	possibly damaging	0.84
R9621:Itpr1	UTSW	6	108416909	missense	probably damaging	1.00
R9632:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9646:Itpr1	UTSW	6	108394884	missense	probably damaging	1.00
R9695:Itpr1	UTSW	6	108401350	missense	probably damaging	1.00
R9710:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9721:Itpr1	UTSW	6	108406102	missense	probably damaging	0.96
R9780:Itpr1	UTSW	6	108510834	missense	probably benign	0.03
Z1176:Itpr1	UTSW	6	108499149	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTTCCTGTTCCACACTGAAATC -3'
(R):5'- TGACAGAGCCACCTTCCATTC -3'

Sequencing Primer
(F):5'- CATGATCATCTGTTATACACTGTGGC -3'
(R):5'- CCATTCTGGCTTTGCAGAATG -3'

Posted On

2016-08-04