Incidental Mutation 'R0491:Fkbp4'
ID42465
Institutional Source Beutler Lab
Gene Symbol Fkbp4
Ensembl Gene ENSMUSG00000030357
Gene NameFK506 binding protein 4
SynonymsFKBP52, FKBP-52
MMRRC Submission 038689-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.681) question?
Stock #R0491 (G1)
Quality Score186
Status Validated
Chromosome6
Chromosomal Location128429735-128438677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128435742 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 75 (I75T)
Ref Sequence ENSEMBL: ENSMUSP00000119930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032508] [ENSMUST00000150387] [ENSMUST00000151796]
Predicted Effect probably damaging
Transcript: ENSMUST00000032508
AA Change: I122T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032508
Gene: ENSMUSG00000030357
AA Change: I122T

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 2.6e-33 PFAM
Pfam:FKBP_C 160 250 1.3e-14 PFAM
TPR 270 303 4.44e1 SMART
TPR 319 352 1.76e-5 SMART
TPR 353 386 2e-4 SMART
low complexity region 419 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139448
SMART Domains Protein: ENSMUSP00000114939
Gene: ENSMUSG00000030357

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 3.8e-33 PFAM
Pfam:FKBP_C 160 250 2.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144745
Predicted Effect probably damaging
Transcript: ENSMUST00000150387
AA Change: I75T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119930
Gene: ENSMUSG00000030357
AA Change: I75T

DomainStartEndE-ValueType
Pfam:FKBP_C 1 88 7.8e-31 PFAM
Pfam:FKBP_C 113 203 4.7e-13 PFAM
Blast:TPR 223 256 3e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000151796
AA Change: I75T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122087
Gene: ENSMUSG00000030357
AA Change: I75T

DomainStartEndE-ValueType
Pfam:FKBP_C 1 88 3.7e-31 PFAM
Pfam:FKBP_C 113 187 3.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204081
Meta Mutation Damage Score 0.9427 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It has high structural and functional similarity to FK506-binding protein 1A (FKBP1A), but unlike FKBP1A, this protein does not have immunosuppressant activity when complexed with FK506. It interacts with interferon regulatory factor-4 and plays an important role in immunoregulatory gene expression in B and T lymphocytes. This encoded protein is known to associate with phytanoyl-CoA alpha-hydroxylase. It can also associate with two heat shock proteins (hsp90 and hsp70) and thus may play a role in the intracellular trafficking of hetero-oligomeric forms of the steroid hormone receptors. This protein correlates strongly with adeno-associated virus type 2 vectors (AAV) resulting in a significant increase in AAV-mediated transgene expression in human cell lines. Thus this encoded protein is thought to have important implications for the optimal use of AAV vectors in human gene therapy. The human genome contains several non-transcribed pseudogenes similar to this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygous null males show reproductive tissue defects consistent with androgen insensitivity such as ambiguous external genitalia, dysgenic prostate, malformed seminal gland and cryptorchism. Males also exhibit hypospadia and infertility. Females are sterile due to failure of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,182,243 S356T probably damaging Het
Abca13 T C 11: 9,298,235 F2661L probably benign Het
Acadsb A G 7: 131,430,107 D224G probably benign Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts2 A G 11: 50,776,630 D465G probably damaging Het
Akap9 A T 5: 3,972,851 probably benign Het
Alms1 A G 6: 85,702,600 T3240A probably damaging Het
Ap3d1 A G 10: 80,719,241 W417R probably damaging Het
Arfgef1 C A 1: 10,179,987 probably benign Het
Atf6 A G 1: 170,787,344 probably null Het
Cacna1s T A 1: 136,089,008 probably benign Het
Clcn1 T C 6: 42,310,581 F740L probably benign Het
Clec12a T A 6: 129,364,053 D265E probably benign Het
Clic3 T A 2: 25,457,785 probably benign Het
Cntnap3 T G 13: 64,762,045 T749P probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Crxos T A 7: 15,898,535 S89T probably benign Het
Cxcr1 G T 1: 74,192,309 P185T possibly damaging Het
Cyp20a1 T A 1: 60,371,327 N262K possibly damaging Het
Dpy19l2 T C 9: 24,696,028 R46G probably benign Het
Dpysl2 A T 14: 66,807,962 L454Q probably damaging Het
Dvl3 C T 16: 20,527,423 probably benign Het
Eppin T A 2: 164,589,412 E98V possibly damaging Het
Fancm A T 12: 65,106,061 H1097L probably benign Het
Fmn2 A G 1: 174,581,959 H586R unknown Het
Gm973 C T 1: 59,558,234 probably benign Het
Haus6 A C 4: 86,602,846 V185G possibly damaging Het
Herc2 T A 7: 56,122,366 C1098S possibly damaging Het
Hic1 C A 11: 75,166,310 L584F possibly damaging Het
Itgb1bp1 C A 12: 21,276,895 probably benign Het
Kbtbd2 G A 6: 56,780,389 R121* probably null Het
Lgr4 C T 2: 110,007,281 probably benign Het
Lrrc55 T C 2: 85,191,920 E309G probably damaging Het
Mertk T C 2: 128,793,107 probably null Het
Micu3 A G 8: 40,366,253 probably benign Het
Mmp11 G A 10: 75,926,758 A287V probably benign Het
Mpzl2 A G 9: 45,042,741 Y47C probably damaging Het
Muc5b A C 7: 141,862,015 R2899S probably benign Het
Myo1b A G 1: 51,755,698 Y1078H probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Ncapd3 T G 9: 27,057,883 V611G probably damaging Het
Ntpcr C T 8: 125,737,354 R73* probably null Het
Olfr1225 A T 2: 89,170,360 V284E probably benign Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Osbp2 A G 11: 3,714,709 F88S probably damaging Het
Pkn3 A T 2: 30,089,877 T711S probably damaging Het
Plekhm1 T C 11: 103,394,776 K278E probably benign Het
Ppp1r36 A G 12: 76,439,291 T408A probably benign Het
Prss41 T C 17: 23,842,503 T105A possibly damaging Het
Psme1 G T 14: 55,579,921 probably benign Het
Ptprq A T 10: 107,608,175 Y1523N probably damaging Het
Ric8b A G 10: 84,992,222 D470G probably damaging Het
Scarb1 A G 5: 125,298,731 probably benign Het
Slc25a54 G A 3: 109,102,796 A204T probably damaging Het
Spink10 T C 18: 62,659,965 C67R probably damaging Het
St5 T A 7: 109,557,204 Q113L probably benign Het
Tmtc1 A T 6: 148,412,640 probably null Het
Tprkb A G 6: 85,924,464 D28G probably benign Het
Ttll13 A G 7: 80,260,350 H747R probably benign Het
Usp24 A G 4: 106,402,105 S1608G probably benign Het
Utp20 A T 10: 88,760,912 F2115L probably damaging Het
Vmn1r200 A T 13: 22,395,191 I46L probably benign Het
Zdhhc8 A T 16: 18,228,390 M103K probably damaging Het
Zfp595 C T 13: 67,317,305 G298E probably damaging Het
Zfp738 T G 13: 67,670,021 H617P possibly damaging Het
Zfp9 A T 6: 118,465,202 H166Q probably damaging Het
Zp3r C A 1: 130,618,334 D80Y probably damaging Het
Other mutations in Fkbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Fkbp4 APN 6 128435791 missense probably benign 0.28
IGL02215:Fkbp4 APN 6 128434470 splice site probably benign
IGL02607:Fkbp4 APN 6 128434470 splice site probably benign
IGL03186:Fkbp4 APN 6 128434800 missense probably benign
IGL03238:Fkbp4 APN 6 128434757 missense probably damaging 1.00
R0083:Fkbp4 UTSW 6 128432407 unclassified probably benign
R1652:Fkbp4 UTSW 6 128436674 missense probably damaging 0.97
R1868:Fkbp4 UTSW 6 128432490 missense probably benign 0.00
R2010:Fkbp4 UTSW 6 128435802 missense probably benign 0.01
R2292:Fkbp4 UTSW 6 128436662 missense probably damaging 1.00
R5616:Fkbp4 UTSW 6 128433554 missense probably damaging 0.99
R6478:Fkbp4 UTSW 6 128433231 missense probably damaging 1.00
R7156:Fkbp4 UTSW 6 128435824 missense probably benign 0.31
Z1177:Fkbp4 UTSW 6 128433111 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAGCCAGTTAACCTTTCCACC -3'
(R):5'- TAAGAACAACACCGCCCTGCTTGTC -3'

Sequencing Primer
(F):5'- CTTACCTCCTACTAAAGCTAGGC -3'
(R):5'- TCTAGAGGTGTTCAGATTCTGC -3'
Posted On2013-05-23