Incidental Mutation 'R5290:Gdpd4'
ID424655
Institutional Source Beutler Lab
Gene Symbol Gdpd4
Ensembl Gene ENSMUSG00000035582
Gene Nameglycerophosphodiester phosphodiesterase domain containing 4
Synonyms
MMRRC Submission 042873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5290 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location97919955-98049663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97966336 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 123 (T123A)
Ref Sequence ENSEMBL: ENSMUSP00000131960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041860] [ENSMUST00000170049]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041860
AA Change: T123A

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036772
Gene: ENSMUSG00000035582
AA Change: T123A

DomainStartEndE-ValueType
transmembrane domain 65 84 N/A INTRINSIC
transmembrane domain 104 135 N/A INTRINSIC
transmembrane domain 148 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 241 263 N/A INTRINSIC
Pfam:GDPD 281 440 1.4e-19 PFAM
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170049
AA Change: T123A

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131960
Gene: ENSMUSG00000035582
AA Change: T123A

DomainStartEndE-ValueType
transmembrane domain 65 84 N/A INTRINSIC
transmembrane domain 104 135 N/A INTRINSIC
transmembrane domain 148 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 241 263 N/A INTRINSIC
Pfam:GDPD 281 439 3.4e-21 PFAM
transmembrane domain 543 565 N/A INTRINSIC
Meta Mutation Damage Score 0.0568 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A T 16: 90,554,210 noncoding transcript Het
2700049A03Rik C A 12: 71,188,791 P1172T probably benign Het
Abi3bp T A 16: 56,642,475 probably null Het
Apod T A 16: 31,311,066 H24L probably damaging Het
Arfgef3 T C 10: 18,600,460 E1537G probably damaging Het
B020004C17Rik T C 14: 57,016,579 V53A possibly damaging Het
Ccdc113 C A 8: 95,540,796 probably null Het
Cd7 T G 11: 121,038,110 D105A probably damaging Het
Celsr3 C T 9: 108,843,158 T2550M probably benign Het
Col6a5 C T 9: 105,946,083 G25D unknown Het
Cps1 A G 1: 67,172,709 M679V probably benign Het
Dync1h1 A T 12: 110,615,068 T316S probably benign Het
Edrf1 T C 7: 133,650,566 Y449H probably damaging Het
Fam92a T C 4: 12,171,195 Q86R probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flg2 A T 3: 93,220,566 I2262L unknown Het
Flnc T C 6: 29,457,554 L2417P probably damaging Het
Gabrp A T 11: 33,567,310 Y121N probably damaging Het
Gm4763 T C 7: 24,723,411 E79G probably benign Het
Gpr162 C A 6: 124,861,269 M139I probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gsn G A 2: 35,296,472 S410N probably benign Het
Gtf2f2 T C 14: 75,897,649 Y212C probably damaging Het
Hao2 C T 3: 98,877,177 A291T probably damaging Het
Igkv1-133 A G 6: 67,725,579 T94A possibly damaging Het
Irf2bp1 G A 7: 19,004,998 A188T possibly damaging Het
Itpr1 T C 6: 108,406,145 V1478A possibly damaging Het
Kdm5b T C 1: 134,622,099 probably null Het
Kif5b A T 18: 6,234,882 D49E probably damaging Het
Lmbr1l A G 15: 98,912,242 W113R probably damaging Het
Lrp2 T C 2: 69,513,354 D887G probably damaging Het
Lrrc14 T A 15: 76,713,943 M291K probably benign Het
Mgarp G A 3: 51,388,966 A205V possibly damaging Het
Msl2 T C 9: 101,101,407 probably null Het
Nfix G A 8: 84,713,777 Q487* probably null Het
Notch4 T C 17: 34,565,289 V22A probably benign Het
Npc1l1 T A 11: 6,222,221 Q823L probably benign Het
Obox3 T C 7: 15,626,849 K122E probably benign Het
Olfr282 T C 15: 98,438,332 Y288H probably damaging Het
Olfr446 A G 6: 42,928,038 K269R probably damaging Het
Olfr509 C T 7: 108,646,548 M9I probably benign Het
Plekhh3 T A 11: 101,166,571 M287L possibly damaging Het
Prpf3 A T 3: 95,853,545 I15K probably benign Het
Rpl12-ps1 G T 1: 36,958,342 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Setd2 T C 9: 110,617,831 V2489A probably damaging Het
Slfn10-ps T A 11: 83,029,025 noncoding transcript Het
Smad2 C T 18: 76,262,724 P78L probably damaging Het
Spen G A 4: 141,473,816 T2500I probably damaging Het
Stmnd1 A G 13: 46,299,598 D250G probably benign Het
Tjp2 T G 19: 24,131,204 E181D probably benign Het
Tmem131l T C 3: 83,899,265 D1478G probably benign Het
Trim72 G T 7: 128,010,004 R326L probably benign Het
Ttn A T 2: 76,897,240 probably benign Het
Vmn1r177 A T 7: 23,866,073 M126K probably damaging Het
Vmn1r57 A G 7: 5,221,320 I281M probably damaging Het
Vmn2r108 C A 17: 20,471,403 R286L probably benign Het
Wdr25 T C 12: 108,898,042 S38P probably benign Het
Wdr78 A T 4: 103,049,533 D694E probably benign Het
Zfp937 T A 2: 150,238,309 Y86* probably null Het
Zfr2 CTCAGACTGGTGTCAGAC CTCAGAC 10: 81,246,710 probably null Het
Zswim1 C T 2: 164,825,925 H366Y probably damaging Het
Other mutations in Gdpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Gdpd4 APN 7 98004271 missense probably damaging 1.00
IGL01292:Gdpd4 APN 7 98014954 splice site probably benign
IGL01317:Gdpd4 APN 7 97998258 missense possibly damaging 0.74
IGL02678:Gdpd4 APN 7 97974377 splice site probably benign
IGL02822:Gdpd4 APN 7 97971924 missense possibly damaging 0.82
IGL02987:Gdpd4 APN 7 97961551 splice site probably benign
R0022:Gdpd4 UTSW 7 97982875 missense probably damaging 1.00
R0331:Gdpd4 UTSW 7 97973008 missense probably benign 0.11
R0882:Gdpd4 UTSW 7 97966298 missense probably damaging 1.00
R1425:Gdpd4 UTSW 7 97974012 missense probably benign 0.03
R1469:Gdpd4 UTSW 7 97974466 splice site probably null
R1469:Gdpd4 UTSW 7 97974466 splice site probably null
R1870:Gdpd4 UTSW 7 97972955 missense probably benign 0.00
R4747:Gdpd4 UTSW 7 97961633 missense possibly damaging 0.80
R5017:Gdpd4 UTSW 7 98004275 nonsense probably null
R5208:Gdpd4 UTSW 7 98014911 missense probably benign 0.11
R5398:Gdpd4 UTSW 7 97971978 missense probably benign 0.00
R5605:Gdpd4 UTSW 7 98006300 missense probably benign 0.41
R5715:Gdpd4 UTSW 7 97961597 missense probably benign 0.00
R5990:Gdpd4 UTSW 7 98040930 missense probably benign 0.00
R6269:Gdpd4 UTSW 7 97974462 missense probably damaging 1.00
R6314:Gdpd4 UTSW 7 97973953 missense probably damaging 0.98
R6817:Gdpd4 UTSW 7 97957830 missense probably benign 0.00
R6884:Gdpd4 UTSW 7 97972175 missense probably damaging 1.00
R7054:Gdpd4 UTSW 7 97973929 missense probably damaging 0.99
Z1088:Gdpd4 UTSW 7 97966309 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATTGGTTAATGCTTCATCTAACC -3'
(R):5'- TGCTCTGTCACCTGCTCAAG -3'

Sequencing Primer
(F):5'- GGTTAATGCTTCATCTAACCCATTC -3'
(R):5'- GCTCAAGGGTCAGCTTTATTAGACTC -3'
Posted On2016-08-04