Incidental Mutation 'R5290:Olfr509'
ID424656
Institutional Source Beutler Lab
Gene Symbol Olfr509
Ensembl Gene ENSMUSG00000049280
Gene Nameolfactory receptor 509
SynonymsGA_x6K02T2PBJ9-10976304-10975339, MOR267-14
MMRRC Submission 042873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5290 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108644336-108651906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108646548 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 9 (M9I)
Ref Sequence ENSEMBL: ENSMUSP00000150157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061690] [ENSMUST00000213756] [ENSMUST00000214861] [ENSMUST00000215075]
Predicted Effect probably benign
Transcript: ENSMUST00000061690
AA Change: M9I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053819
Gene: ENSMUSG00000049280
AA Change: M9I

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.8e-42 PFAM
Pfam:7tm_1 39 288 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213756
AA Change: M9I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214861
AA Change: M9I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215075
AA Change: M9I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A T 16: 90,554,210 noncoding transcript Het
2700049A03Rik C A 12: 71,188,791 P1172T probably benign Het
Abi3bp T A 16: 56,642,475 probably null Het
Apod T A 16: 31,311,066 H24L probably damaging Het
Arfgef3 T C 10: 18,600,460 E1537G probably damaging Het
B020004C17Rik T C 14: 57,016,579 V53A possibly damaging Het
Ccdc113 C A 8: 95,540,796 probably null Het
Cd7 T G 11: 121,038,110 D105A probably damaging Het
Celsr3 C T 9: 108,843,158 T2550M probably benign Het
Col6a5 C T 9: 105,946,083 G25D unknown Het
Cps1 A G 1: 67,172,709 M679V probably benign Het
Dync1h1 A T 12: 110,615,068 T316S probably benign Het
Edrf1 T C 7: 133,650,566 Y449H probably damaging Het
Fam92a T C 4: 12,171,195 Q86R probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flg2 A T 3: 93,220,566 I2262L unknown Het
Flnc T C 6: 29,457,554 L2417P probably damaging Het
Gabrp A T 11: 33,567,310 Y121N probably damaging Het
Gdpd4 A G 7: 97,966,336 T123A possibly damaging Het
Gm4763 T C 7: 24,723,411 E79G probably benign Het
Gpr162 C A 6: 124,861,269 M139I probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gsn G A 2: 35,296,472 S410N probably benign Het
Gtf2f2 T C 14: 75,897,649 Y212C probably damaging Het
Hao2 C T 3: 98,877,177 A291T probably damaging Het
Igkv1-133 A G 6: 67,725,579 T94A possibly damaging Het
Irf2bp1 G A 7: 19,004,998 A188T possibly damaging Het
Itpr1 T C 6: 108,406,145 V1478A possibly damaging Het
Kdm5b T C 1: 134,622,099 probably null Het
Kif5b A T 18: 6,234,882 D49E probably damaging Het
Lmbr1l A G 15: 98,912,242 W113R probably damaging Het
Lrp2 T C 2: 69,513,354 D887G probably damaging Het
Lrrc14 T A 15: 76,713,943 M291K probably benign Het
Mgarp G A 3: 51,388,966 A205V possibly damaging Het
Msl2 T C 9: 101,101,407 probably null Het
Nfix G A 8: 84,713,777 Q487* probably null Het
Notch4 T C 17: 34,565,289 V22A probably benign Het
Npc1l1 T A 11: 6,222,221 Q823L probably benign Het
Obox3 T C 7: 15,626,849 K122E probably benign Het
Olfr282 T C 15: 98,438,332 Y288H probably damaging Het
Olfr446 A G 6: 42,928,038 K269R probably damaging Het
Plekhh3 T A 11: 101,166,571 M287L possibly damaging Het
Prpf3 A T 3: 95,853,545 I15K probably benign Het
Rpl12-ps1 G T 1: 36,958,342 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Setd2 T C 9: 110,617,831 V2489A probably damaging Het
Slfn10-ps T A 11: 83,029,025 noncoding transcript Het
Smad2 C T 18: 76,262,724 P78L probably damaging Het
Spen G A 4: 141,473,816 T2500I probably damaging Het
Stmnd1 A G 13: 46,299,598 D250G probably benign Het
Tjp2 T G 19: 24,131,204 E181D probably benign Het
Tmem131l T C 3: 83,899,265 D1478G probably benign Het
Trim72 G T 7: 128,010,004 R326L probably benign Het
Ttn A T 2: 76,897,240 probably benign Het
Vmn1r177 A T 7: 23,866,073 M126K probably damaging Het
Vmn1r57 A G 7: 5,221,320 I281M probably damaging Het
Vmn2r108 C A 17: 20,471,403 R286L probably benign Het
Wdr25 T C 12: 108,898,042 S38P probably benign Het
Wdr78 A T 4: 103,049,533 D694E probably benign Het
Zfp937 T A 2: 150,238,309 Y86* probably null Het
Zfr2 CTCAGACTGGTGTCAGAC CTCAGAC 10: 81,246,710 probably null Het
Zswim1 C T 2: 164,825,925 H366Y probably damaging Het
Other mutations in Olfr509
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Olfr509 APN 7 108645836 missense possibly damaging 0.47
IGL02015:Olfr509 APN 7 108646013 missense probably damaging 0.99
IGL02721:Olfr509 APN 7 108646375 nonsense probably null
IGL03170:Olfr509 APN 7 108646100 missense probably benign 0.00
R0746:Olfr509 UTSW 7 108646041 missense probably damaging 1.00
R0863:Olfr509 UTSW 7 108645658 missense probably benign 0.00
R1791:Olfr509 UTSW 7 108646364 missense probably benign 0.30
R4128:Olfr509 UTSW 7 108646426 missense probably benign 0.03
R5878:Olfr509 UTSW 7 108645739 missense probably damaging 1.00
R6030:Olfr509 UTSW 7 108646226 missense possibly damaging 0.87
R6030:Olfr509 UTSW 7 108646226 missense possibly damaging 0.87
R6545:Olfr509 UTSW 7 108646455 missense probably damaging 1.00
R7699:Olfr509 UTSW 7 108645672 missense probably damaging 1.00
R7700:Olfr509 UTSW 7 108645672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTCTGAAAAGGACAGGGC -3'
(R):5'- TGGGGTTTGAGCAGATCTACATAC -3'

Sequencing Primer
(F):5'- TTTCTGAAAAGGACAGGGCAAAGAG -3'
(R):5'- GCTCTTAGTCACTTTGTATACATGTG -3'
Posted On2016-08-04