Incidental Mutation 'R5290:Npc1l1'
ID424667
Institutional Source Beutler Lab
Gene Symbol Npc1l1
Ensembl Gene ENSMUSG00000020447
Gene NameNPC1 like intracellular cholesterol transporter 1
Synonyms9130221N23Rik, Niemann-Pick disease, type C1
MMRRC Submission 042873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R5290 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location6211013-6230143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6222221 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 823 (Q823L)
Ref Sequence ENSEMBL: ENSMUSP00000004505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004505]
Predicted Effect probably benign
Transcript: ENSMUST00000004505
AA Change: Q823L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447
AA Change: Q823L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NPC1_N 28 283 8.7e-74 PFAM
low complexity region 294 307 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:Patched 385 897 4.7e-52 PFAM
Pfam:Sterol-sensing 661 815 5.7e-55 PFAM
Pfam:MMPL 665 830 2.3e-11 PFAM
Pfam:Patched 1063 1268 6.2e-34 PFAM
Meta Mutation Damage Score 0.1060 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A T 16: 90,554,210 noncoding transcript Het
2700049A03Rik C A 12: 71,188,791 P1172T probably benign Het
Abi3bp T A 16: 56,642,475 probably null Het
Apod T A 16: 31,311,066 H24L probably damaging Het
Arfgef3 T C 10: 18,600,460 E1537G probably damaging Het
B020004C17Rik T C 14: 57,016,579 V53A possibly damaging Het
Ccdc113 C A 8: 95,540,796 probably null Het
Cd7 T G 11: 121,038,110 D105A probably damaging Het
Celsr3 C T 9: 108,843,158 T2550M probably benign Het
Col6a5 C T 9: 105,946,083 G25D unknown Het
Cps1 A G 1: 67,172,709 M679V probably benign Het
Dync1h1 A T 12: 110,615,068 T316S probably benign Het
Edrf1 T C 7: 133,650,566 Y449H probably damaging Het
Fam92a T C 4: 12,171,195 Q86R probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flg2 A T 3: 93,220,566 I2262L unknown Het
Flnc T C 6: 29,457,554 L2417P probably damaging Het
Gabrp A T 11: 33,567,310 Y121N probably damaging Het
Gdpd4 A G 7: 97,966,336 T123A possibly damaging Het
Gm4763 T C 7: 24,723,411 E79G probably benign Het
Gpr162 C A 6: 124,861,269 M139I probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gsn G A 2: 35,296,472 S410N probably benign Het
Gtf2f2 T C 14: 75,897,649 Y212C probably damaging Het
Hao2 C T 3: 98,877,177 A291T probably damaging Het
Igkv1-133 A G 6: 67,725,579 T94A possibly damaging Het
Irf2bp1 G A 7: 19,004,998 A188T possibly damaging Het
Itpr1 T C 6: 108,406,145 V1478A possibly damaging Het
Kdm5b T C 1: 134,622,099 probably null Het
Kif5b A T 18: 6,234,882 D49E probably damaging Het
Lmbr1l A G 15: 98,912,242 W113R probably damaging Het
Lrp2 T C 2: 69,513,354 D887G probably damaging Het
Lrrc14 T A 15: 76,713,943 M291K probably benign Het
Mgarp G A 3: 51,388,966 A205V possibly damaging Het
Msl2 T C 9: 101,101,407 probably null Het
Nfix G A 8: 84,713,777 Q487* probably null Het
Notch4 T C 17: 34,565,289 V22A probably benign Het
Obox3 T C 7: 15,626,849 K122E probably benign Het
Olfr282 T C 15: 98,438,332 Y288H probably damaging Het
Olfr446 A G 6: 42,928,038 K269R probably damaging Het
Olfr509 C T 7: 108,646,548 M9I probably benign Het
Plekhh3 T A 11: 101,166,571 M287L possibly damaging Het
Prpf3 A T 3: 95,853,545 I15K probably benign Het
Rpl12-ps1 G T 1: 36,958,342 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Setd2 T C 9: 110,617,831 V2489A probably damaging Het
Slfn10-ps T A 11: 83,029,025 noncoding transcript Het
Smad2 C T 18: 76,262,724 P78L probably damaging Het
Spen G A 4: 141,473,816 T2500I probably damaging Het
Stmnd1 A G 13: 46,299,598 D250G probably benign Het
Tjp2 T G 19: 24,131,204 E181D probably benign Het
Tmem131l T C 3: 83,899,265 D1478G probably benign Het
Trim72 G T 7: 128,010,004 R326L probably benign Het
Ttn A T 2: 76,897,240 probably benign Het
Vmn1r177 A T 7: 23,866,073 M126K probably damaging Het
Vmn1r57 A G 7: 5,221,320 I281M probably damaging Het
Vmn2r108 C A 17: 20,471,403 R286L probably benign Het
Wdr25 T C 12: 108,898,042 S38P probably benign Het
Wdr78 A T 4: 103,049,533 D694E probably benign Het
Zfp937 T A 2: 150,238,309 Y86* probably null Het
Zfr2 CTCAGACTGGTGTCAGAC CTCAGAC 10: 81,246,710 probably null Het
Zswim1 C T 2: 164,825,925 H366Y probably damaging Het
Other mutations in Npc1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Npc1l1 APN 11 6224199 missense probably damaging 1.00
IGL01348:Npc1l1 APN 11 6227974 missense probably damaging 1.00
IGL01891:Npc1l1 APN 11 6214280 missense probably damaging 1.00
IGL01897:Npc1l1 APN 11 6227879 missense probably benign
IGL02098:Npc1l1 APN 11 6214581 missense probably damaging 0.99
IGL02121:Npc1l1 APN 11 6228157 missense probably benign
IGL02724:Npc1l1 APN 11 6214684 missense possibly damaging 0.88
IGL02947:Npc1l1 APN 11 6229246 missense probably benign 0.01
IGL03328:Npc1l1 APN 11 6218643 nonsense probably null
R0137:Npc1l1 UTSW 11 6228148 nonsense probably null
R0322:Npc1l1 UTSW 11 6229042 missense probably benign
R0352:Npc1l1 UTSW 11 6223076 missense probably benign 0.00
R0492:Npc1l1 UTSW 11 6223040 missense possibly damaging 0.82
R0918:Npc1l1 UTSW 11 6218239 missense probably damaging 1.00
R1300:Npc1l1 UTSW 11 6227859 missense probably damaging 1.00
R1455:Npc1l1 UTSW 11 6228174 missense possibly damaging 0.66
R1588:Npc1l1 UTSW 11 6217785 missense probably benign 0.01
R1803:Npc1l1 UTSW 11 6228846 missense probably damaging 1.00
R1882:Npc1l1 UTSW 11 6217473 splice site probably null
R1944:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6225199 nonsense probably null
R3155:Npc1l1 UTSW 11 6221840 missense probably benign
R4343:Npc1l1 UTSW 11 6217773 missense probably benign
R4504:Npc1l1 UTSW 11 6228741 missense possibly damaging 0.61
R4610:Npc1l1 UTSW 11 6228215 missense probably damaging 1.00
R4807:Npc1l1 UTSW 11 6218723 missense probably damaging 1.00
R4829:Npc1l1 UTSW 11 6214010 critical splice donor site probably null
R5135:Npc1l1 UTSW 11 6224245 missense possibly damaging 0.94
R5369:Npc1l1 UTSW 11 6217705 critical splice donor site probably null
R5388:Npc1l1 UTSW 11 6214733 missense probably damaging 1.00
R5532:Npc1l1 UTSW 11 6224245 missense probably damaging 0.98
R5540:Npc1l1 UTSW 11 6214546 missense probably damaging 1.00
R5754:Npc1l1 UTSW 11 6227839 missense probably damaging 1.00
R5760:Npc1l1 UTSW 11 6229031 missense probably benign 0.02
R6057:Npc1l1 UTSW 11 6217806 missense possibly damaging 0.66
R6388:Npc1l1 UTSW 11 6224145 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214013 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214014 missense probably damaging 0.98
R6756:Npc1l1 UTSW 11 6215153 missense probably damaging 1.00
R6790:Npc1l1 UTSW 11 6214260 splice site probably null
R7006:Npc1l1 UTSW 11 6217731 missense probably benign
R7062:Npc1l1 UTSW 11 6217807 missense probably benign
R7273:Npc1l1 UTSW 11 6218320 missense probably damaging 1.00
R7383:Npc1l1 UTSW 11 6217777 missense probably benign 0.30
X0022:Npc1l1 UTSW 11 6228058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTCCAAGTGTCTGCTCCG -3'
(R):5'- ACGCCCCTAAAAGTATGTAAAGTTTAC -3'

Sequencing Primer
(F):5'- TGTCTGCTCCGGGCCTG -3'
(R):5'- CAGCCTGGCCTATAAAGTGAGTTAC -3'
Posted On2016-08-04